v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) hsa-miR-139-5p secondary structure diagram

Homo sapiens (human) hsa-miR-139-5p URS000025D232_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-139: Hsa-mir-139 is a microRNA that was identified as one of the down-regulated miRNAs, comprising 22.9% of the total differentially expressed miRNAs in the context provided, suggesting a potential role in cellular processes [PMC4627364]. Research has highlighted the significant impact of hsa-mir-139 on colorectal cancer (CRC) progression, indicating that alterations in its expression could be pivotal in the disease's development and could serve as a biomarker or therapeutic target [PMC7913431].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUACAGUGCACGUGUCUCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (domestic cattle) bta-miR-139
  2. Callithrix jacchus cja-miR-139
  3. Canis lupus familiaris (dog) Cfa-Mir-139_5p (mature (guide))
  4. Cervus elaphus cel-miR-139
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-139-5p
  6. Echinops telfairi Ete-Mir-139_5p (mature (guide))
  7. Equus caballus (horse) Eca-Mir-139_5p (mature (guide))
  8. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-31040
  9. Loxodonta africana (African savanna elephant) Laf-Mir-139_5p (mature (guide))
  10. Macaca mulatta Mml-Mir-139_5p (mature (guide))
  11. Microcebus murinus (gray mouse lemur) Mmr-Mir-139_5p (mature (guide))
  12. Mus musculus (house mouse) Mmu-Mir-139_5p (mature (guide))
  13. Oryctolagus cuniculus ocu-miR-139-5p
  14. Pongo abelii (Sumatran orangutan) Pab-Mir-139_5p (mature (co-guide))
  15. Rattus norvegicus Rno-Mir-139_5p (mature (guide))
  16. Tupaia chinensis (Chinese tree shrew) tch-miR-139-5p
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 GoFlow Results Publications