v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles dirus tRNA secondary structure diagram

Anopheles dirus tRNA URS00002442A1_7168

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGUCGGUGGUGUAAUGGUCAGCAUAGUUGCCUUCCAAGCAGUUGAUCCGGGUUCGAUUCCCGGCCGACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 99 other species

  1. Aedes aegypti tRNA AAEL016274
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Gly
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA glycine (anticodon UCC)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glycine (anticodon UCC)
  5. Anopheles albimanus tRNA tRNA-Gly
  6. Anopheles arabiensis tRNA tRNA-Gly
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Gly
  9. Anopheles coluzzii tRNA-Gly for anticodon UCC
  10. Anopheles culicifacies tRNA tRNA-Gly
  11. Anopheles darlingi (American malaria mosquito) tRNA Glycine
  12. Anopheles epiroticus (Mosquito) tRNA tRNA-Gly
  13. Anopheles farauti (Mosquito) tRNA tRNA-Gly
  14. Anopheles funestus tRNA-Gly for anticodon UCC
  15. Anopheles gambiae tRNA tRNA-Gly
  16. Anopheles gambiae str. PEST tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 9)
  17. Anopheles maculatus tRNA tRNA-Gly
  18. Anopheles melas (Mosquito) tRNA tRNA-Gly
  19. Anopheles merus tRNA tRNA-Gly
  20. Anopheles minimus tRNA tRNA-Gly
  21. Anopheles quadriannulatus tRNA tRNA-Gly
  22. Anopheles sinensis tRNA tRNA-Gly
  23. Anopheles stephensi tRNA tRNA-Gly
  24. Bactrocera dorsalis (Oriental fruit fly) tRNA-Gly
  25. Bactrocera latifrons tRNA-Gly
  26. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glycine (anticodon UCC)
  27. Bactrocera tryoni (Queensland fruitfly) tRNA-Gly
  28. Chrysodeixis includens tRNA
  29. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015244.1
  30. Ctenocephalides felis (Cat flea) tRNA-Gly
  31. Culex pipiens pallens (Northern house mosquito) transfer RNA glycine (anticodon UCC)
  32. Culex quinquefasciatus tRNA-Gly
  33. Diatraea saccharalis (sugarcane borer) tRNA
  34. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon UCC)
  35. Drosophila ananassae tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  36. Drosophila arizonae (Fruit fly) tRNA-Gly
  37. Drosophila bipectinata (Fruit fly) tRNA-Gly
  38. Drosophila busckii (Fruit fly) tRNA-Gly
  39. Drosophila elegans (Fruit fly) tRNA-Gly
  40. Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  41. Drosophila eugracilis (Fruit fly) tRNA-Gly
  42. Drosophila ficusphila (Fruit fly) tRNA-Gly
  43. Drosophila grimshawi tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  44. Drosophila guanche (Fruit fly) tRNA-Gly
  45. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon UCC)
  46. Drosophila hydei (Fruit fly) tRNA-Gly
  47. Drosophila innubila (Fruit fly) tRNA-Gly
  48. Drosophila kikkawai (Fruit fly) tRNA-Gly
  49. Drosophila mauritiana (Fruit fly) tRNA-Gly
  50. Drosophila melanogaster (fruit fly) transfer RNA:Glycine-TCC 2-2 (Dmel_CR30406, Dmel_CR30407)
  51. Drosophila miranda (Fruit fly) tRNA-Gly
  52. Drosophila mojavensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  53. Drosophila navojoa (Fruit fly) tRNA-Gly
  54. Drosophila obscura (Fruit fly) tRNA-Gly
  55. Drosophila persimilis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  56. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  57. Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  58. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  59. Drosophila santomea (Fruit fly) tRNA-Gly
  60. Drosophila sechellia tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  61. Drosophila simulans tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  62. Drosophila subobscura (Fruit fly) tRNA-Gly
  63. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  64. Drosophila suzukii (Fruit fly) tRNA-Gly
  65. Drosophila takahashii (Fruit fly) tRNA-Gly
  66. Drosophila teissieri (Fruit fly) tRNA-Gly
  67. Drosophila virilis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  68. Drosophila willistoni tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  69. Drosophila yakuba tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  70. Heliconius melpomene (Postman butterfly) tRNA HMEL003542
  71. Helicoverpa armigera transfer RNA glycine (anticodon UCC)
  72. Helicoverpa zea tRNA-Gly
  73. Heliothis virescens (tobacco budworm) tRNA
  74. Hermetia illucens (Black soldier fly) tRNA-Gly
  75. Ladona fulva tRNA
  76. Leptidea sinapis tRNA
  77. Lucilia cuprina tRNA-Gly for anticodon UCC
  78. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011554.1
  79. Malaya genurostris (Mosquitos) transfer RNA glycine (anticodon UCC)
  80. Megaselia scalaris tRNA-Gly for anticodon UCC
  81. Musca domestica (House fly) tRNA MDOA002158
  82. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005012983.1
  83. Operophtera brumata (winter moth) tRNA
  84. Arctia plantaginis Parasemia plantaginis tRNA
  85. Pieris brassicae (large cabbage white) tRNA
  86. Pieris macdunnoughi tRNA
  87. Plutella xylostella (diamondback moth) tRNA
  88. Rhagoletis pomonella (Apple magot fly) tRNA-Gly
  89. Spodoptera exigua (beet armyworm) tRNA
  90. Spodoptera frugiperda tRNA-Gly (TCC) (tRNA-Gly-TCC-3 1 to 6)
  91. Spodoptera littoralis tRNA
  92. Spodoptera litura tRNA
  93. Stomoxys calcitrans (Stable fly) tRNA-Gly
  94. Topomyia yanbarensis (Mosquitos) transfer RNA glycine (anticodon UCC)
  95. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glycine (anticodon UCC)
  96. Trichoplusia ni (cabbage looper) tRNA
  97. Uranotaenia lowii (Mosquitos) transfer RNA glycine (anticodon UCC)
  98. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glycine (anticodon UCC)
  99. Zerene cesonia tRNA-Gly
  100. Zeugodacus cucurbitae (Melon fly) transfer RNA glycine (anticodon UCC)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications