v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles funestus (African malaria mosquito) tRNA-Gly for anticodon UCC secondary structure diagram

Anopheles funestus (African malaria mosquito) tRNA-Gly for anticodon UCC URS00002442A1_62324

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGUCGGUGGUGUAAUGGUCAGCAUAGUUGCCUUCCAAGCAGUUGAUCCGGGUUCGAUUCCCGGCCGACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 107 other species

  1. Aedes aegypti tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 22)
  2. Aedes albopictus tRNA tRNA-Gly
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA glycine (anticodon UCC)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glycine (anticodon UCC)
  5. Anopheles albimanus (Mosquitos) tRNA-Gly
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Gly
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Gly
  9. Anopheles coluzzii tRNA-Gly for anticodon UCC
  10. Anopheles culicifacies tRNA tRNA-Gly
  11. Anopheles darlingi (American malaria mosquito) tRNA Glycine
  12. Anopheles dirus tRNA
  13. Anopheles epiroticus (Mosquito) tRNA tRNA-Gly
  14. Anopheles farauti (Mosquito) tRNA tRNA-Gly
  15. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Gly
  16. Anopheles gambiae str. PEST tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 9)
  17. Anopheles maculatus (Mosquito) tRNA tRNA-Gly
  18. Anopheles melas (Mosquito) tRNA tRNA-Gly
  19. Anopheles merus tRNA tRNA-Gly
  20. Anopheles minimus tRNA tRNA-Gly
  21. Anopheles quadriannulatus tRNA tRNA-Gly
  22. Anopheles sinensis (Mosquito) tRNA tRNA-Gly
  23. Anopheles stephensi tRNA tRNA-Gly
  24. Bactrocera dorsalis transfer RNA glycine (anticodon UCC)
  25. Bactrocera latifrons (Solanum fruit fly) tRNA-Gly
  26. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glycine (anticodon UCC)
  27. Bactrocera oleae (Olive fruit fly) tRNA-Gly
  28. Bactrocera tryoni (Queensland fruitfly) tRNA-Gly
  29. Chrysodeixis includens tRNA
  30. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015244.1
  31. Ctenocephalides felis (Cat flea) tRNA-Gly
  32. Culex pipiens pallens (Northern house mosquito) transfer RNA glycine (anticodon UCC)
  33. Culex quinquefasciatus tRNA
  34. Diatraea saccharalis (sugarcane borer) tRNA
  35. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon UCC)
  36. Drosophila ananassae tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  37. Drosophila arizonae (Fruit fly) tRNA-Gly
  38. Drosophila bipectinata (Pomace flies) transfer RNA glycine (anticodon UCC)
  39. Drosophila busckii (Fruit fly) tRNA-Gly
  40. Drosophila elegans (Pomace flies) tRNA-Gly
  41. Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  42. Drosophila eugracilis (Fruit fly) tRNA-Gly
  43. Drosophila ficusphila (Fruit fly) tRNA-Gly
  44. Drosophila grimshawi tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  45. Drosophila guanche (Fruit fly) tRNA-Gly
  46. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon UCC)
  47. Drosophila hydei (Fruit fly) tRNA-Gly
  48. Drosophila innubila (Fruit fly) tRNA-Gly
  49. Drosophila kikkawai (Pomace flies) transfer RNA glycine (anticodon UCC)
  50. Drosophila mauritiana (Fruit fly) tRNA-Gly
  51. Drosophila melanogaster transfer RNA:Glycine-TCC 2-2 (Dmel_CR30406, Dmel_CR30407)
  52. Drosophila miranda (Fruit fly) tRNA-Gly
  53. Drosophila mojavensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  54. Drosophila montana (Pomace flies) transfer RNA glycine (anticodon UCC)
  55. Drosophila nasuta (Pomace flies) transfer RNA glycine (anticodon UCC)
  56. Drosophila navojoa (Fruit fly) tRNA-Gly
  57. Drosophila novamexicana (Pomace flies) tRNA-Gly
  58. Drosophila obscura (Fruit fly) tRNA-Gly
  59. Drosophila persimilis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  60. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  61. Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  62. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  63. Drosophila santomea (Fruit fly) tRNA-Gly
  64. Drosophila sechellia tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  65. Drosophila serrata (Pomace flies) tRNA-Gly
  66. Drosophila simulans tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  67. Drosophila subobscura (Fruit fly) tRNA-Gly
  68. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  69. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glycine (anticodon UCC)
  70. Drosophila suzukii (Pomace flies) transfer RNA glycine (anticodon UCC)
  71. Drosophila takahashii (Pomace flies) transfer RNA glycine (anticodon UCC)
  72. Drosophila teissieri (Fruit fly) tRNA-Gly
  73. Drosophila tropicalis (Pomace flies) transfer RNA glycine (anticodon UCC)
  74. Drosophila virilis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  75. Drosophila willistoni tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  76. Drosophila yakuba tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  77. Heliconius melpomene tRNA HMEL003542
  78. Helicoverpa armigera transfer RNA glycine (anticodon UCC)
  79. Helicoverpa zea tRNA-Gly
  80. Heliothis virescens (tobacco budworm) tRNA
  81. Hermetia illucens (Black soldier fly) tRNA-Gly
  82. Ischnura elegans (Damselflies) tRNA-Gly
  83. Ladona fulva tRNA
  84. Leptidea sinapis tRNA
  85. Lucilia cuprina (Australian sheep blowfly) tRNA-Gly for anticodon UCC
  86. Lucilia sericata (Common green bottle fly) tRNA-Gly
  87. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011554.1
  88. Malaya genurostris (Mosquitos) transfer RNA glycine (anticodon UCC)
  89. Megaselia scalaris tRNA-Gly for anticodon UCC
  90. Musca domestica (House fly) transfer RNA glycine (anticodon UCC)
  91. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013287.1
  92. Operophtera brumata (winter moth) tRNA
  93. Arctia plantaginis Parasemia plantaginis tRNA
  94. Phthorimaea operculella tRNA-Gly
  95. Pieris brassicae (large cabbage white) tRNA
  96. Pieris macdunnoughi tRNA
  97. Plutella xylostella (diamondback moth) tRNA
  98. Rhagoletis pomonella tRNA-Gly
  99. Spodoptera exigua (beet armyworm) tRNA
  100. Spodoptera frugiperda tRNA-Gly (TCC) (tRNA-Gly-TCC-3 1 to 6)
  101. Spodoptera littoralis tRNA
  102. Spodoptera litura tRNA
  103. Stomoxys calcitrans (stable fly) transfer RNA glycine (anticodon UCC)
  104. Topomyia yanbarensis (Mosquitos) transfer RNA glycine (anticodon UCC)
  105. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glycine (anticodon UCC)
  106. Trichoplusia ni (cabbage looper) tRNA
  107. Uranotaenia lowii (Mosquitos) transfer RNA glycine (anticodon UCC)
  108. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glycine (anticodon UCC)
  109. Zerene cesonia (Southern Dogface) tRNA-Gly
  110. Zeugodacus cucurbitae (Melon fly) transfer RNA glycine (anticodon UCC)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications