Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Stomoxys calcitrans (stable fly) transfer RNA glycine (anticodon UCC) secondary structure diagram

Stomoxys calcitrans (stable fly) transfer RNA glycine (anticodon UCC) URS00002442A1_35570

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUCGGUGGUGUAAUGGUCAGCAUAGUUGCCUUCCAAGCAGUUGAUCCGGGUUCGAUUCCCGGCCGACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 107 other species

  1. Aedes aegypti tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 22)
  2. Aedes albopictus tRNA tRNA-Gly
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA glycine (anticodon UCC)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glycine (anticodon UCC)
  5. Anopheles albimanus (Mosquitos) tRNA-Gly
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Gly
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Gly
  9. Anopheles coluzzii tRNA-Gly for anticodon UCC
  10. Anopheles culicifacies tRNA tRNA-Gly
  11. Anopheles darlingi (American malaria mosquito) tRNA Glycine
  12. Anopheles dirus tRNA
  13. Anopheles epiroticus (Mosquito) tRNA tRNA-Gly
  14. Anopheles farauti (Mosquito) tRNA tRNA-Gly
  15. Anopheles funestus (African malaria mosquito) tRNA-Gly for anticodon UCC
  16. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Gly
  17. Anopheles gambiae str. PEST tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 9)
  18. Anopheles maculatus (Mosquito) tRNA tRNA-Gly
  19. Anopheles melas (Mosquito) tRNA tRNA-Gly
  20. Anopheles merus tRNA tRNA-Gly
  21. Anopheles minimus tRNA tRNA-Gly
  22. Anopheles quadriannulatus tRNA tRNA-Gly
  23. Anopheles sinensis (Mosquito) tRNA tRNA-Gly
  24. Anopheles stephensi tRNA tRNA-Gly
  25. Bactrocera dorsalis transfer RNA glycine (anticodon UCC)
  26. Bactrocera latifrons (Solanum fruit fly) tRNA-Gly
  27. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glycine (anticodon UCC)
  28. Bactrocera oleae (Olive fruit fly) tRNA-Gly
  29. Bactrocera tryoni (Queensland fruitfly) tRNA-Gly
  30. Chrysodeixis includens tRNA
  31. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015244.1
  32. Ctenocephalides felis (Cat flea) tRNA-Gly
  33. Culex pipiens pallens (Northern house mosquito) transfer RNA glycine (anticodon UCC)
  34. Culex quinquefasciatus tRNA
  35. Diatraea saccharalis (sugarcane borer) tRNA
  36. Drosophila albomicans (Fruit fly) transfer RNA glycine (anticodon UCC)
  37. Drosophila ananassae tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  38. Drosophila arizonae (Fruit fly) tRNA-Gly
  39. Drosophila bipectinata (Pomace flies) transfer RNA glycine (anticodon UCC)
  40. Drosophila busckii (Fruit fly) tRNA-Gly
  41. Drosophila elegans (Pomace flies) tRNA-Gly
  42. Drosophila erecta tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  43. Drosophila eugracilis (Fruit fly) tRNA-Gly
  44. Drosophila ficusphila (Fruit fly) tRNA-Gly
  45. Drosophila grimshawi tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  46. Drosophila guanche (Fruit fly) tRNA-Gly
  47. Drosophila gunungcola (Fruit fly) transfer RNA glycine (anticodon UCC)
  48. Drosophila hydei (Fruit fly) tRNA-Gly
  49. Drosophila innubila (Fruit fly) tRNA-Gly
  50. Drosophila kikkawai (Pomace flies) transfer RNA glycine (anticodon UCC)
  51. Drosophila mauritiana (Fruit fly) tRNA-Gly
  52. Drosophila melanogaster transfer RNA:Glycine-TCC 2-2 (Dmel_CR30406, Dmel_CR30407)
  53. Drosophila miranda (Fruit fly) tRNA-Gly
  54. Drosophila mojavensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  55. Drosophila montana (Pomace flies) transfer RNA glycine (anticodon UCC)
  56. Drosophila nasuta (Pomace flies) transfer RNA glycine (anticodon UCC)
  57. Drosophila navojoa (Fruit fly) tRNA-Gly
  58. Drosophila novamexicana (Pomace flies) tRNA-Gly
  59. Drosophila obscura (Fruit fly) tRNA-Gly
  60. Drosophila persimilis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  61. Drosophila pseudoobscura (Fruit fly) tRNA-Gly
  62. Drosophila pseudoobscura pseudoobscura tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  63. Drosophila rhopaloa (Fruit fly) tRNA-Gly
  64. Drosophila santomea (Fruit fly) tRNA-Gly
  65. Drosophila sechellia tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  66. Drosophila serrata (Pomace flies) tRNA-Gly
  67. Drosophila simulans tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  68. Drosophila subobscura (Fruit fly) tRNA-Gly
  69. Drosophila subpulchrella (Fruit fly) tRNA-Gly
  70. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glycine (anticodon UCC)
  71. Drosophila suzukii (Pomace flies) transfer RNA glycine (anticodon UCC)
  72. Drosophila takahashii (Pomace flies) transfer RNA glycine (anticodon UCC)
  73. Drosophila teissieri (Fruit fly) tRNA-Gly
  74. Drosophila tropicalis (Pomace flies) transfer RNA glycine (anticodon UCC)
  75. Drosophila virilis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  76. Drosophila willistoni tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  77. Drosophila yakuba tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  78. Heliconius melpomene tRNA HMEL003542
  79. Helicoverpa armigera transfer RNA glycine (anticodon UCC)
  80. Helicoverpa zea tRNA-Gly
  81. Heliothis virescens (tobacco budworm) tRNA
  82. Hermetia illucens (Black soldier fly) tRNA-Gly
  83. Ischnura elegans (Damselflies) tRNA-Gly
  84. Ladona fulva tRNA
  85. Leptidea sinapis tRNA
  86. Lucilia cuprina (Australian sheep blowfly) tRNA-Gly for anticodon UCC
  87. Lucilia sericata (Common green bottle fly) tRNA-Gly
  88. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011554.1
  89. Malaya genurostris (Mosquitos) transfer RNA glycine (anticodon UCC)
  90. Megaselia scalaris tRNA-Gly for anticodon UCC
  91. Musca domestica (House fly) transfer RNA glycine (anticodon UCC)
  92. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013287.1
  93. Operophtera brumata (winter moth) tRNA
  94. Arctia plantaginis Parasemia plantaginis tRNA
  95. Phthorimaea operculella tRNA-Gly
  96. Pieris brassicae (large cabbage white) tRNA
  97. Pieris macdunnoughi tRNA
  98. Plutella xylostella (diamondback moth) tRNA
  99. Rhagoletis pomonella tRNA-Gly
  100. Spodoptera exigua (beet armyworm) tRNA
  101. Spodoptera frugiperda tRNA-Gly (TCC) (tRNA-Gly-TCC-3 1 to 6)
  102. Spodoptera littoralis tRNA
  103. Spodoptera litura tRNA
  104. Topomyia yanbarensis (Mosquitos) transfer RNA glycine (anticodon UCC)
  105. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glycine (anticodon UCC)
  106. Trichoplusia ni (cabbage looper) tRNA
  107. Uranotaenia lowii (Mosquitos) transfer RNA glycine (anticodon UCC)
  108. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glycine (anticodon UCC)
  109. Zerene cesonia (Southern Dogface) tRNA-Gly
  110. Zeugodacus cucurbitae (Melon fly) transfer RNA glycine (anticodon UCC)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...