v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-187-3p URS00001EB9FC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-187: Hsa-mir-187 is one of the eight miRNAs that have been functionally proven to be associated with the pathogenesis of primary open-angle glaucoma (POAG) in cells and animal models [PMC9034601]. In a study, the top eight downregulated miRNAs, including hsa-mir-187, and the top eight upregulated miRNAs were presented in Figure 1A [PMC5696168]. Furthermore, hsa-mir-187 was identified as one of the shared differentially expressed miRNAs (DEmiRNAs) in atrial fibrillation (AF) and myocardial infarction (MI) [PMC8629660].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCGUGUCUUGUGUUGCAGCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus bta-miR-187
  2. Callithrix jacchus cja-miR-187
  3. Canis lupus familiaris (dog) cfa-miR-187
  4. Cavia porcellus (domestic guinea pig) cpo-miR-187-3p
  5. Cervus elaphus (red deer) Cel-miR-187
  6. Dasypus novemcinctus dno-miR-187-3p
  7. Equus caballus (horse) eca-miR-187
  8. Macaca mulatta mml-miR-187-3p
  9. Mus musculus mmu-miR-187-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-187-3p
  11. Pteropus alecto pal-miR-187-3p
  12. Rattus norvegicus (Norway rat) rno-miR-187-3p
  13. Sus scrofa (pig) ssc-miR-187
 Publications