Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-187 URS00001EB9FC_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGUGUCUUGUGUUGCAGCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus bta-miR-187
  2. Callithrix jacchus cja-miR-187
  3. Canis lupus familiaris (dog) cfa-miR-187
  4. Cavia porcellus (domestic guinea pig) cpo-miR-187-3p
  5. Cervus elaphus (red deer) Cel-miR-187
  6. Dasypus novemcinctus dno-miR-187-3p
  7. Homo sapiens hsa-miR-187-3p
  8. Macaca mulatta mml-miR-187-3p
  9. Mus musculus mmu-miR-187-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-187-3p
  11. Pteropus alecto pal-miR-187-3p
  12. Rattus norvegicus (Norway rat) rno-miR-187-3p
  13. Sus scrofa (pig) ssc-miR-187
Publications