Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-142a-5p URS00001E0AEA_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (LncBase, miRBase, PirBase, MirGeneDB, ENA, TarBase, RefSeq). Described in 44 papers. Mus musculus (house mouse) mmu-miR-142a-5p sequence is a product of Mir142, mmu-miR-142a, mmu-miR-142a-5p, miR-142a-5p, miR-142a, miR-142 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610010O12Rik, 0610030G24Rik, 0610033L19Rik, 0610040D20Rik, 0710001G09Rik, 0710008J23Rik, 0910001A06Rik, 1010001J12Rik, 1010001P14Rik, 1110001A07Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUAAAGUAGAAAGCACUACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-142-P3-v1_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-142-P4-v1_5p (mature (guide))
    3. Bos taurus Bta-Mir-142-v1_5p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-142-v1_5p (mature (guide))
    5. Cavia porcellus cpo-miR-142-5p
    6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-142-P3-v1_5p (mature (guide))
    7. Columba livia (rock pigeon) cli-miR-142-5p
    8. Danio rerio (zebrafish) dre-miR-142a-5p
    9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-142-5p
    10. Echinops telfairi Ete-Mir-142-v1_5p (mature (guide))
    11. Equus caballus eca-miR-142-5p
    12. Gadus morhua (Atlantic cod) gmo-miR-142-5p
    13. Gallus gallus (chicken) Gga-Mir-142-P3-v1_5p (mature (guide))
    14. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-142-5p
    15. Homo sapiens hsa-miR-142-5p
    16. Macaca mulatta (Rhesus monkey) mml-miR-142-5p
    17. Maylandia zebra mze-miR-142
    18. Monodelphis domestica Mdo-Mir-142-v1_5p (mature (guide))
    19. Neolamprologus brichardi nbr-miR-142
    20. Oreochromis niloticus oni-miR-142
    21. Ornithorhynchus anatinus (platypus) oan-miR-142-5p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-142-5p
    23. Pongo pygmaeus ppy-miR-142-5p
    24. Pundamilia nyererei pny-miR-142
    25. Rattus norvegicus (Norway rat) rno-miR-142-5p
    26. Salmo salar ssa-miR-142a-5p
    27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-142-v1_5p (mature (guide))
    28. Scyliorhinus torazame Sto-Mir-142-v1_5p (mature (guide))
    29. Sus scrofa ssc-miR-142-5p
    30. Taeniopygia guttata Tgu-Mir-142-P3-v1_5p (mature (guide))
    31. Takifugu rubripes fru-miR-142
    32. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-142a
    33. Tor tambroides (Thai mahseer) miR-142a-5p
    34. Xenopus tropicalis Xtr-Mir-142-P6-v1_5p (mature (guide))