v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Tyrosine-GTA 1-4 (multiple genes) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Tyrosine-GTA 1-4 (multiple genes) URS00001D6C17_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUUCGAUAGCUCAGUUGGUAGAGCGGUGGACUGUAGAUCCAUAGGUCGCUGGUUCAAAUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 99 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior tRNA-Tyr
  3. Acyrthosiphon pisum (Pea aphid) tRNA-Tyr
  4. Aethina tumida (Small hive beetle) transfer RNA tyrosine (anticodon GUA)
  5. Agrilus planipennis tRNA-Tyr
  6. Amyelois transitella tRNA-Tyr
  7. Anopheles gambiae str. PEST tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  8. Anthonomus grandis grandis transfer RNA tyrosine (anticodon GUA)
  9. Aphidius gifuensis tRNA-Tyr
  10. Apis dorsata (Giant honeybee) tRNA-Tyr
  11. Apis florea (Dwarf honeybee) tRNA-Tyr
  12. Apis mellifera tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  13. Aromia moschata tRNA-OTHER
  14. Athalia rosae (Coleseed sawfly) tRNA-Tyr
  15. Atta cephalotes tRNA LOC105616950-2
  16. Bactrocera dorsalis tRNA-Tyr
  17. Bactrocera latifrons tRNA-Tyr
  18. Bactrocera tryoni (Queensland fruitfly) tRNA-Tyr
  19. Bicyclus anynana tRNA-Tyr
  20. Bombus huntii (Hunt's bumblebee) transfer RNA tyrosine (anticodon GUA)
  21. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119734
  22. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Tyr
  23. Bombyx mandarina (Wild silkworm) tRNA-Tyr
  24. Bombyx mori tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 12)
  25. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-8-1)
  26. Callosobruchus analis hypothetical protein
  27. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  28. Camponotus floridanus (Florida carpenter ant) tRNA-Tyr
  29. Cataglyphis hispanica (Desert ant) transfer RNA tyrosine (anticodon GUA)
  30. Ceratitis capitata (Mediterranean fruit fly) tRNA-Tyr
  31. Chelonus insularis tRNA-Tyr
  32. Copidosoma floridanum tRNA-Tyr
  33. Culex quinquefasciatus (Southern house mosquito) tRNA-Tyr
  34. Daphnia magna (Fresh water planktonic) tRNA-Tyr
  35. Dendroctonus ponderosae tRNA-Tyr
  36. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA tyrosine (anticodon GUA)
  37. Diuraphis noxia (Russian wheat aphid) tRNA-Tyr
  38. Drosophila ananassae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  39. Drosophila erecta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  40. Drosophila grimshawi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
  41. Drosophila gunungcola tRNA-OTHER
  42. Drosophila mojavensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  43. Drosophila persimilis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  44. Drosophila pseudoobscura pseudoobscura tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  45. Drosophila sechellia tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  46. Drosophila simulans tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 10)
  47. Drosophila virilis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
  48. Drosophila willistoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  49. Drosophila yakuba tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  50. Dufourea novaeangliae (Bee) tRNA-Tyr
  51. Eufriesea mexicana tRNA-Tyr
  52. Eumeta japonica tRNA-Tyr
  53. Exocentrus adspersus tRNA-OTHER
  54. Frieseomelitta varia tRNA-Tyr
  55. Galleria mellonella tRNA-Tyr
  56. Habropoda laboriosa tRNA-Tyr
  57. Harpegnathos saltator tRNA-Tyr
  58. Helicoverpa armigera transfer RNA tyrosine (anticodon GUA)
  59. Helicoverpa zea (Corn earworm) tRNA-Tyr
  60. Hermetia illucens tRNA-Tyr
  61. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Tyr
  62. Leguminivora glycinivorella (Soybean pod borer) tRNA-Tyr
  63. Lepeophtheirus salmonis tRNA-Tyr
  64. Leptinotarsa decemlineata tRNA-Tyr
  65. Linepithema humile (Argentine ant) tRNA-Tyr
  66. Lucilia cuprina (Australian sheep blowfly) tRNA-Tyr
  67. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA tyrosine (anticodon GUA)
  68. Manduca sexta (Tobacco hornworm) tRNA-Tyr
  69. Megachile rotundata tRNA-Tyr
  70. Melampsora pinitorqua Mpini7 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  71. Molorchus minor tRNA-OTHER
  72. Monomorium pharaonis (Pharaoh ant) tRNA-Tyr
  73. Musca domestica tRNA MDOA001972
  74. Nasonia vitripennis (Jewel wasp) tRNA-Tyr
  75. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Tyr
  76. Neodiprion pinetum (White pine sawfly) tRNA-Tyr
  77. Onthophagus taurus tRNA-Tyr
  78. Ooceraea biroi tRNA-Tyr
  79. Orussus abietinus tRNA-Tyr
  80. Oryza glaberrima (African rice) tRNA EPlOGLG00000000169
  81. Pararge aegeria tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 12)
  82. Patiria miniata (Bat star starfish) tRNA-Tyr
  83. Pectinophora gossypiella transfer RNA tyrosine (anticodon GUA)
  84. Pogonomyrmex barbatus (Red harvester ant) tRNA-Tyr
  85. Polistes canadensis tRNA-Tyr
  86. Polistes dominula tRNA-Tyr
  87. Polistes fuscatus tRNA-Tyr
  88. Rhagoletis pomonella tRNA-Tyr
  89. Rhamnusium bicolor tRNA-OTHER
  90. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Tyr
  91. Sipha flava (Yellow sugarcane aphid) tRNA-Tyr
  92. Sitophilus oryzae tRNA-Tyr
  93. Spodoptera frugiperda tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 19)
  94. Stomoxys calcitrans tRNA-Tyr
  95. Thrips palmi tRNA-Tyr
  96. Trichogramma pretiosum tRNA-Tyr
  97. Trichomalopsis sarcophagae tRNA-OTHER
  98. Venturia canescens tRNA-Tyr
  99. Zerene cesonia (Southern Dogface) tRNA-Tyr
 2D structure