Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhopalosiphum maidis (Corn leaf aphid) tRNA-Tyr secondary structure diagram

Rhopalosiphum maidis (Corn leaf aphid) tRNA-Tyr URS00001D6C17_43146

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUCGAUAGCUCAGUUGGUAGAGCGGUGGACUGUAGAUCCAUAGGUCGCUGGUUCAAAUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 99 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior tRNA-Tyr
  3. Acyrthosiphon pisum (Pea aphid) tRNA-Tyr
  4. Aethina tumida (Small hive beetle) transfer RNA tyrosine (anticodon GUA)
  5. Agrilus planipennis tRNA-Tyr
  6. Amyelois transitella tRNA-Tyr
  7. Anopheles gambiae str. PEST tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  8. Anthonomus grandis grandis transfer RNA tyrosine (anticodon GUA)
  9. Aphidius gifuensis tRNA-Tyr
  10. Apis dorsata (Giant honeybee) tRNA-Tyr
  11. Apis florea (Dwarf honeybee) tRNA-Tyr
  12. Apis mellifera tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  13. Aromia moschata tRNA-OTHER
  14. Athalia rosae (Coleseed sawfly) tRNA-Tyr
  15. Atta cephalotes tRNA LOC105616950-2
  16. Bactrocera dorsalis tRNA-Tyr
  17. Bactrocera latifrons tRNA-Tyr
  18. Bactrocera tryoni (Queensland fruitfly) tRNA-Tyr
  19. Bicyclus anynana tRNA-Tyr
  20. Bombus huntii (Hunt's bumblebee) transfer RNA tyrosine (anticodon GUA)
  21. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119734
  22. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Tyr
  23. Bombyx mandarina (Wild silkworm) tRNA-Tyr
  24. Bombyx mori tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 12)
  25. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-8-1)
  26. Callosobruchus analis hypothetical protein
  27. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  28. Camponotus floridanus (Florida carpenter ant) tRNA-Tyr
  29. Cataglyphis hispanica (Desert ant) transfer RNA tyrosine (anticodon GUA)
  30. Ceratitis capitata (Mediterranean fruit fly) tRNA-Tyr
  31. Chelonus insularis tRNA-Tyr
  32. Copidosoma floridanum tRNA-Tyr
  33. Culex quinquefasciatus (Southern house mosquito) tRNA-Tyr
  34. Daphnia magna (Fresh water planktonic) tRNA-Tyr
  35. Dendroctonus ponderosae tRNA-Tyr
  36. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA tyrosine (anticodon GUA)
  37. Diuraphis noxia (Russian wheat aphid) tRNA-Tyr
  38. Drosophila ananassae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  39. Drosophila erecta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  40. Drosophila grimshawi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
  41. Drosophila gunungcola tRNA-OTHER
  42. Drosophila melanogaster transfer RNA:Tyrosine-GTA 1-4 (multiple genes)
  43. Drosophila mojavensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  44. Drosophila persimilis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  45. Drosophila pseudoobscura pseudoobscura tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  46. Drosophila sechellia tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  47. Drosophila simulans tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 10)
  48. Drosophila virilis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
  49. Drosophila willistoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  50. Drosophila yakuba tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  51. Dufourea novaeangliae (Bee) tRNA-Tyr
  52. Eufriesea mexicana tRNA-Tyr
  53. Eumeta japonica tRNA-Tyr
  54. Exocentrus adspersus tRNA-OTHER
  55. Frieseomelitta varia tRNA-Tyr
  56. Galleria mellonella tRNA-Tyr
  57. Habropoda laboriosa tRNA-Tyr
  58. Harpegnathos saltator tRNA-Tyr
  59. Helicoverpa armigera transfer RNA tyrosine (anticodon GUA)
  60. Helicoverpa zea (Corn earworm) tRNA-Tyr
  61. Hermetia illucens tRNA-Tyr
  62. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Tyr
  63. Leguminivora glycinivorella (Soybean pod borer) tRNA-Tyr
  64. Lepeophtheirus salmonis tRNA-Tyr
  65. Leptinotarsa decemlineata tRNA-Tyr
  66. Linepithema humile (Argentine ant) tRNA-Tyr
  67. Lucilia cuprina (Australian sheep blowfly) tRNA-Tyr
  68. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA tyrosine (anticodon GUA)
  69. Manduca sexta (Tobacco hornworm) tRNA-Tyr
  70. Megachile rotundata tRNA-Tyr
  71. Melampsora pinitorqua Mpini7 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  72. Molorchus minor tRNA-OTHER
  73. Monomorium pharaonis (Pharaoh ant) tRNA-Tyr
  74. Musca domestica tRNA MDOA001972
  75. Nasonia vitripennis (Jewel wasp) tRNA-Tyr
  76. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Tyr
  77. Neodiprion pinetum (White pine sawfly) tRNA-Tyr
  78. Onthophagus taurus tRNA-Tyr
  79. Ooceraea biroi tRNA-Tyr
  80. Orussus abietinus tRNA-Tyr
  81. Oryza glaberrima (African rice) tRNA EPlOGLG00000000169
  82. Pararge aegeria tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 12)
  83. Patiria miniata (Bat star starfish) tRNA-Tyr
  84. Pectinophora gossypiella transfer RNA tyrosine (anticodon GUA)
  85. Pogonomyrmex barbatus (Red harvester ant) tRNA-Tyr
  86. Polistes canadensis tRNA-Tyr
  87. Polistes dominula tRNA-Tyr
  88. Polistes fuscatus tRNA-Tyr
  89. Rhagoletis pomonella tRNA-Tyr
  90. Rhamnusium bicolor tRNA-OTHER
  91. Sipha flava (Yellow sugarcane aphid) tRNA-Tyr
  92. Sitophilus oryzae tRNA-Tyr
  93. Spodoptera frugiperda tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 19)
  94. Stomoxys calcitrans tRNA-Tyr
  95. Thrips palmi tRNA-Tyr
  96. Trichogramma pretiosum tRNA-Tyr
  97. Trichomalopsis sarcophagae tRNA-OTHER
  98. Venturia canescens tRNA-Tyr
  99. Zerene cesonia (Southern Dogface) tRNA-Tyr
2D structure