Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callosobruchus chinensis (azuki bean weevil) hypothetical protein secondary structure diagram

Callosobruchus chinensis (azuki bean weevil) hypothetical protein URS00001D6C17_146774

  • 73 nucleotides
  • 1 database (ENA)
  • Found in 145 other species
  • tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUCGAUAGCUCAGUUGGUAGAGCGGUGGACUGUAGAUCCAUAGGUCGCUGGUUCAAAUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 145 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior tRNA-Tyr
  3. Acyrthosiphon pisum (Pea aphid) tRNA-Tyr
  4. Aethina tumida (Small hive beetle) transfer RNA tyrosine (anticodon GUA)
  5. Agrilus planipennis tRNA-Tyr
  6. Amyelois transitella tRNA-Tyr
  7. Anastrepha ludens (Mexican fruit fly) transfer RNA tyrosine (anticodon GUA)
  8. Anastrepha obliqua (WestIndian fruit fly) transfer RNA tyrosine (anticodon GUA)
  9. Anopheles gambiae str. PEST tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  10. Anthonomus grandis grandis (Boll weevil) transfer RNA tyrosine (anticodon GUA)
  11. Aphidius gifuensis (Parasitoid wasp) tRNA-Tyr
  12. Apis dorsata tRNA-Tyr
  13. Apis florea (Dwarf honeybee) tRNA-Tyr
  14. Apis mellifera tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  15. Aromia moschata tRNA-OTHER
  16. Athalia rosae (Coleseed sawfly) tRNA-Tyr
  17. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616950-2
  18. Bactrocera dorsalis tRNA-Tyr
  19. Bactrocera latifrons tRNA-Tyr
  20. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA tyrosine (anticodon GUA)
  21. Bactrocera tryoni (Queensland fruitfly) tRNA-Tyr
  22. Bicyclus anynana (Squinting bush brown) tRNA-Tyr
  23. Bombus affinis (Rusty patched bumble bee) transfer RNA tyrosine (anticodon GUA)
  24. Bombus huntii (Hunt's bumblebee) transfer RNA tyrosine (anticodon GUA)
  25. Bombus terrestris tRNA LOC110119734
  26. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Tyr
  27. Bombyx mandarina (Wild silkworm) tRNA-Tyr
  28. Bombyx mori tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 12)
  29. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-8-1)
  30. Callosobruchus analis hypothetical protein
  31. Camponotus floridanus tRNA-Tyr
  32. Cataglyphis hispanica (Desert ant) transfer RNA tyrosine (anticodon GUA)
  33. Ceratitis capitata tRNA-Tyr
  34. Chelonus insularis tRNA-Tyr
  35. Copidosoma floridanum tRNA-Tyr
  36. Ctenocephalides felis (Cat flea) tRNA-Tyr
  37. Culex pipiens pallens (Northern house mosquito) transfer RNA tyrosine (anticodon GUA)
  38. Culex quinquefasciatus tRNA-Tyr
  39. Cylas formicarius (Sweet potato weevil) transfer RNA tyrosine (anticodon GUA)
  40. Daphnia magna (Fresh water planktonic) tRNA-Tyr
  41. Dendroctonus ponderosae tRNA-Tyr
  42. Diabrotica virgifera virgifera transfer RNA tyrosine (anticodon GUA)
  43. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA tyrosine (anticodon GUA)
  44. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA tyrosine (anticodon GUA)
  45. Diuraphis noxia (Russian wheat aphid) tRNA-Tyr
  46. Drosophila albomicans (Fruit fly) transfer RNA tyrosine (anticodon GUA)
  47. Drosophila ananassae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  48. Drosophila arizonae (Fruit fly) tRNA-Tyr
  49. Drosophila biarmipes (Fruit fly) transfer RNA tyrosine (anticodon GUA)
  50. Drosophila bipectinata (Fruit fly) tRNA-Tyr
  51. Drosophila busckii (Fruit fly) tRNA-Tyr
  52. Drosophila elegans (Fruit fly) tRNA-Tyr
  53. Drosophila erecta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  54. Drosophila eugracilis (Fruit fly) tRNA-Tyr
  55. Drosophila ficusphila (Fruit fly) tRNA-Tyr
  56. Drosophila grimshawi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 7)
  57. Drosophila guanche (Fruit fly) tRNA-Tyr
  58. Drosophila gunungcola (Fruit fly) transfer RNA tyrosine (anticodon GUA)
  59. Drosophila hydei (Fruit fly) tRNA-Tyr
  60. Drosophila innubila (Fruit fly) tRNA-Tyr
  61. Drosophila kikkawai (Fruit fly) tRNA-Tyr
  62. Drosophila mauritiana (Fruit fly) tRNA-Tyr
  63. Drosophila melanogaster transfer RNA:Tyrosine-GTA 1-4 (multiple genes)
  64. Drosophila miranda (Fruit fly) tRNA-Tyr
  65. Drosophila mojavensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  66. Drosophila navojoa (Fruit fly) tRNA-Tyr
  67. Drosophila obscura (Fruit fly) tRNA-Tyr
  68. Drosophila persimilis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  69. Drosophila pseudoobscura (Fruit fly) tRNA-Tyr
  70. Drosophila pseudoobscura pseudoobscura tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  71. Drosophila rhopaloa (Fruit fly) tRNA-Tyr
  72. Drosophila santomea (Fruit fly) tRNA-Tyr
  73. Drosophila sechellia tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  74. Drosophila simulans tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 10)
  75. Drosophila subobscura (Fruit fly) tRNA-Tyr
  76. Drosophila subpulchrella (Fruit fly) tRNA-Tyr
  77. Drosophila suzukii (Fruit fly) tRNA-Tyr
  78. Drosophila takahashii (Fruit fly) tRNA-Tyr
  79. Drosophila teissieri (Fruit fly) tRNA-Tyr
  80. Drosophila virilis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 6)
  81. Drosophila willistoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 8)
  82. Drosophila yakuba tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  83. Dufourea novaeangliae tRNA-Tyr
  84. Eufriesea mexicana (Bee) tRNA-Tyr
  85. Eumeta japonica tRNA-Tyr
  86. Exocentrus adspersus tRNA-OTHER
  87. Frieseomelitta varia tRNA-Tyr
  88. Galleria mellonella (Greater wax moth) tRNA-Tyr
  89. Habropoda laboriosa tRNA-Tyr
  90. Harpegnathos saltator tRNA-Tyr
  91. Helicoverpa armigera transfer RNA tyrosine (anticodon GUA)
  92. Helicoverpa zea (Corn earworm) tRNA-Tyr
  93. Hermetia illucens tRNA-Tyr
  94. Homalodisca vitripennis tRNA-Tyr
  95. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA tyrosine (anticodon GUA)
  96. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA tyrosine (anticodon GUA)
  97. Leguminivora glycinivorella (Soybean pod borer) tRNA-Tyr
  98. Lepeophtheirus salmonis (Salmon louse) tRNA-Tyr
  99. Leptinotarsa decemlineata tRNA-Tyr
  100. Linepithema humile (Argentine ant) tRNA-Tyr
  101. Lucilia cuprina tRNA-Tyr
  102. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA tyrosine (anticodon GUA)
  103. Malaya genurostris (Mosquitos) transfer RNA tyrosine (anticodon GUA)
  104. Manduca sexta tRNA-Tyr
  105. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Tyr
  106. Melampsora pinitorqua Mpini7 tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  107. Melanaphis sacchari (Sugarcane aphid) tRNA-Tyr
  108. Microplitis demolitor (Parasitoid wasp) transfer RNA tyrosine (anticodon GUA)
  109. Microplitis mediator (Endoparasitoid wasp) transfer RNA tyrosine (anticodon GUA)
  110. Molorchus minor tRNA-OTHER
  111. Monomorium pharaonis tRNA-Tyr
  112. Musca domestica (House fly) tRNA MDOA001972
  113. Nasonia vitripennis (Jewel wasp) tRNA-Tyr
  114. Neodiprion lecontei tRNA-Tyr
  115. Neodiprion pinetum (White pine sawfly) tRNA-Tyr
  116. Onthophagus taurus tRNA-Tyr
  117. Ooceraea biroi tRNA-Tyr
  118. Orussus abietinus tRNA-Tyr
  119. Oryza glaberrima tRNA EPlOGLG00000000169
  120. Pararge aegeria tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 12)
  121. Patiria miniata (Bat star starfish) tRNA-Tyr
  122. Pectinophora gossypiella (Pink bollworm) transfer RNA tyrosine (anticodon GUA)
  123. Phlebotomus argentipes (Sand fly) transfer RNA tyrosine (anticodon GUA)
  124. Plodia interpunctella (Indianmeal moth) transfer RNA tyrosine (anticodon GUA)
  125. Pogonomyrmex barbatus tRNA-Tyr
  126. Polistes canadensis tRNA-Tyr
  127. Polistes dominula (European paper wasp) tRNA-Tyr
  128. Polistes fuscatus (Common paper wasp) tRNA-Tyr
  129. Rhagoletis pomonella (Apple magot fly) tRNA-Tyr
  130. Rhamnusium bicolor tRNA-OTHER
  131. Rhopalosiphum maidis tRNA-Tyr
  132. Sipha flava (Yellow sugarcane aphid) tRNA-Tyr
  133. Sitophilus oryzae tRNA-Tyr
  134. Spodoptera frugiperda tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 19)
  135. Stomoxys calcitrans (Stable fly) tRNA-Tyr
  136. Thrips palmi tRNA-Tyr
  137. Topomyia yanbarensis (Mosquitos) transfer RNA tyrosine (anticodon GUA)
  138. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA tyrosine (anticodon GUA)
  139. Tribolium madens (Black flour beetle) tRNA-Tyr
  140. Trichogramma pretiosum (Parasitoid wasp) tRNA-Tyr
  141. Trichomalopsis sarcophagae tRNA-OTHER
  142. Uranotaenia lowii (Mosquitos) transfer RNA tyrosine (anticodon GUA)
  143. Venturia canescens tRNA-Tyr
  144. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA tyrosine (anticodon GUA)
  145. Zerene cesonia tRNA-Tyr
  146. Zeugodacus cucurbitae (Melon fly) transfer RNA tyrosine (anticodon GUA)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...