Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-23a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-23a precursor URS00001CC864_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-23a: Hsa-mir-23a is a microRNA that was identified as significantly deregulated in the saliva of patients with resectable pancreatic ductal adenocarcinoma (PDAC) when compared to a healthy control group [PMC4486170]. Despite its deregulation, hsa-mir-23a was not selected for further investigation in the study because it did not meet the criterion of exhibiting at least a four-fold change in expression between PDAC patients and healthy individuals [PMC4486170]. Additionally, hsa-mir-23a was among the microRNAs that were found to be elevated in PDAC patients, indicating its potential involvement in the disease process, although its exact role and mechanism were not elucidated within this study [PMC4486170]. However, the statement that microRNAs, including hsa-mir-23a, have been implicated in various biological processes and diseases such as central nervous system development, congenital abnormalities, and heart problems cannot be substantiated with the provided reference [PMC9004059], and therefore should be excluded from the summary.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGUCACAAAUCACAUUGCCAGGGAUUUCCAACCGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications