v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-23a precursor URS00001CC864_9545

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGUCACAAAUCACAUUGCCAGGGAUUUCCAACCGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Cercocebus atys miRNA (ENSCATG00000018806.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 23a (ENSCSAG00000023409.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000006865.1)
  4. Gorilla gorilla gorilla ggo-mir-23a (ENSGGOG00000034050.2)
  5. Gorilla gorilla (western gorilla) microRNA ggo-mir-23a precursor
  6. Homo sapiens microRNA hsa-mir-23a precursor
  7. Macaca fascicularis microRNA 23a (ENSMFAG00000015800.2)
  8. Macaca mulatta microRNA mml-mir-23a precursor
  9. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000017761.1)
  10. Pan paniscus microRNA ppa-mir-23a precursor
  11. Pan troglodytes (chimpanzee) microRNA ptr-mir-23a precursor
  12. Papio anubis miRNA (ENSPANG00000014858.3)
  13. Piliocolobus tephrosceles miRNA (ENSPTEG00000000324.1)
  14. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021000.2)
  15. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-23a precursor
  16. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000012335.1)
  17. Rhinopithecus roxellana miRNA (ENSRROG00000006717.1)
  18. Theropithecus gelada microRNA 23a (ENSTGEG00000006283.1)