Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-149_5p (mature (guide)) URS00001C770D_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCUCCGUGUCUUCACUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-149-5p
  2. Canis lupus familiaris cfa-miR-149
  3. Cavia porcellus cpo-miR-149-5p
  4. Cervus elaphus (red deer) cel-miR-149
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-149-5p
  6. Eptesicus fuscus efu-miR-149
  7. Equus caballus eca-miR-149
  8. Gorilla gorilla gorilla ggo-miR-149 (MIR149)
  9. Gorilla gorilla (western gorilla) ggo-miR-149
  10. Homo sapiens hsa-miR-149-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-149-5p
  12. Mus musculus mmu-miR-149-5p
  13. Oryctolagus cuniculus Ocu-Mir-149_5p (mature (guide))
  14. Pan troglodytes (chimpanzee) ptr-miR-149
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-149
  16. Rattus norvegicus (Norway rat) rno-miR-149-5p
  17. Sus scrofa (pig) ssc-miR-149