Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-149-5p URS00001C770D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-149: mmu-mir-149 is a microRNA that plays a role in the regulation of gene expression in mice, and its silencing by Helicobacter pylori infection has been implicated in the promotion of pro-tumor properties in stromal fibroblasts [PMC4423088]. This silencing effect is associated with increased production of the pro-inflammatory cytokine IL-6, which is known to contribute to tumor progression [PMC5576273]. The targeting relationship between mmu-mir-149 and the 3′-UTR of IL-6 has been experimentally validated, highlighting a potential mechanism by which H. pylori infection could influence tumor microenvironments [PMC4423088]. Research involving oligonucleotides such as mmu-mir-149 mimics and inhibitors has facilitated the study of its function and regulation [PMC4423088]. Additionally, analysis of mouse ENCODE data revealed a conserved CpG-rich region upstream of mmu-mir-149 that could be relevant for its expression regulation [PMC4423088]. The differential expression of mmu-mir-149 among other microRNAs has been monitored using specific primers in studies comparing irradiated versus control samples, further emphasizing its significance in gene expression modulation under various conditions [PMC8349067].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCUCCGUGUCUUCACUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Relationships

Molecular Relationships

GoFlow Results Publications