Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-149 URS00001C770D_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-149: ssc-mir-149 is a highly expressed microRNA in immature HZ boars and is found to target the SPATA3 gene [PMC9622794]. It has been identified along with other miRNAs, including ssc-miR-370 and ssc-miR-615, based on their fold change and expression [PMC9622794]. The downregulation of ssc-mir-149 has been shown to regulate C-JUN expression, potentially promoting immune responses [PMC6354428]. The expression level of ssc-mir-149 in SCs is significantly higher compared to other cell types, indicating its importance in regulatory roles [PMC7429792]. However, the transfection of an ssc-mir-149 inhibitor does not affect the expression of NFKB1, NFKB2, NIK, and RelB [PMC7429792]. It has been further demonstrated that TRAF3 is a target of ssc-mir-149 through the analysis of TRAF3 downstream gene expression upon overexpression of ssc-mir-149 [PMC7429792]. In summary, ssc-mir-149 is a highly expressed microRNA that targets the SPATA3 gene in immature HZ boars. It plays a regulatory role in immune responses by downregulating C-JUN expression. Additionally, it has a significantly higher expression level in SCs compared to other cell types. TRAF3 has been identified as a target gene for ssc-mir-149. However, transfection with an inhibitor for this microRNA does not affect the expression of certain genes involved in immune responses. These findings contribute to our understanding of the regulatory roles and targets of ssc-mir-149 [PMC9622794] [PMC6354428] [PMC7429792].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCUCCGUGUCUUCACUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-149-5p
  2. Canis lupus familiaris cfa-miR-149
  3. Cavia porcellus cpo-miR-149-5p
  4. Cervus elaphus (red deer) cel-miR-149
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-149-5p
  6. Echinops telfairi Ete-Mir-149_5p (mature (guide))
  7. Eptesicus fuscus efu-miR-149
  8. Equus caballus eca-miR-149
  9. Gorilla gorilla gorilla ggo-miR-149 (MIR149)
  10. Gorilla gorilla (western gorilla) ggo-miR-149
  11. Homo sapiens hsa-miR-149-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-149-5p
  13. Mus musculus mmu-miR-149-5p
  14. Oryctolagus cuniculus Ocu-Mir-149_5p (mature (guide))
  15. Pan troglodytes (chimpanzee) ptr-miR-149
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-149
  17. Rattus norvegicus (Norway rat) rno-miR-149-5p
Publications