Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-497 URS00001BC212_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-497: Ssc-mir-497 is a microRNA that was tested in a study, where qPCR amplification was performed using primers designed for the human homolog sequences, indicating 100% homology [PMC6598998]. In the study, several microRNAs were found to be up-regulated in both groups, including ssc-mir-497 [PMC6598998]. Additionally, ssc-mir-497 was found to be involved in regulating the cell cycle and Neurotrophin signaling pathway through corresponding putative target genes [PMC4934789]. Furthermore, ssc-mir-497 was highly expressed in hpiPSCs compared to mpiPSCs [PMC4934789]. The P53 signaling pathway was also regulated by ssc-mir-497 through targeting specific genes [PMC4934789]. Interestingly, ssc-mir-497 and ssc-miR-195 were highly expressed in hpiPSCs and were located in the same genome loci on chromosome 12 [PMC4934789]. Additionally, several miRNAs including ssc-miR-744 and ssc-miR-338 were reported to have important roles in myogenesis [PMC6737989], indicating their potential significance. Overall, these findings highlight the involvement of ssc-mir-497 in various cellular processes and its potential role in myogenesis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCACACUGUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-497
  2. Canis lupus familiaris cfa-miR-497
  3. Equus caballus (horse) eca-miR-497
  4. Homo sapiens hsa-miR-497-5p
  5. Macaca mulatta mml-miR-497-5p
  6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-497-5p
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72460
  8. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-497
  9. Otolemur garnettii oga-miR-497
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-497
  11. Pteropus alecto (black flying fox) pal-miR-497-5p
  12. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62961
  13. Sarcophilus harrisii sha-miR-497
Publications