Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-497 URS00001BC212_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCACACUGUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-497
  2. Equus caballus (horse) eca-miR-497
  3. Homo sapiens hsa-miR-497-5p
  4. Macaca mulatta mml-miR-497-5p
  5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-497-5p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72460
  7. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-497
  8. Otolemur garnettii oga-miR-497
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-497
  10. Pteropus alecto (black flying fox) pal-miR-497-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62961
  12. Sarcophilus harrisii sha-miR-497
  13. Sus scrofa (pig) ssc-miR-497
Publications