Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-497-5p URS00001BC212_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, TarBase, GeneCards, miRBase, RefSeq, ENA, PSICQUIC, LncBase). Homo sapiens (human) hsa-miR-497-5p sequence is a product of hsa-miR-497, MIR497, hsa-RG-3, hsa-miR-497-5p, miR-497-5p, RG-3, miR-497 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 10-fTHF, 14-3-3, 156DAG, 15E1.2, 182-FIP, 2-COP, 20D7-FC4, 2OST, 2P1, 3-OST-5.

Interactions 10

According to PSICQUIC, Homo sapiens (human) hsa-miR-497-5p interacts with:

Interaction id Participant Synonyms
URS00001BC212_9606-7 O14920 O14920
URS00001BC212_9606-0 O14920 O14920
URS00001BC212_9606-1 O15111 O15111
URS00001BC212_9606-8 P05067 P05067
URS00001BC212_9606-2 P05067 P05067
URS00001BC212_9606-3 P05067 P05067
URS00001BC212_9606-9 P35968 P35968
URS00001BC212_9606-4 P35968 P35968
URS00001BC212_9606-5 P56817 P56817
URS00001BC212_9606-6 Q8N5C8 Q8N5C8

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGCAGCACACUGUGGUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Callithrix jacchus cja-miR-497
    2. Canis lupus familiaris cfa-miR-497
    3. Equus caballus (horse) eca-miR-497
    4. Macaca mulatta (Rhesus monkey) mml-miR-497-5p
    5. Monodelphis domestica mdo-miR-497-5p
    6. Mus musculus Mus_musculus piRNA piR-mmu-72460
    7. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-497
    8. Otolemur garnettii oga-miR-497
    9. Pongo pygmaeus (Bornean orangutan) ppy-miR-497
    10. Pteropus alecto (black flying fox) pal-miR-497-5p
    11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62961
    12. Sarcophilus harrisii sha-miR-497
    13. Sus scrofa (pig) ssc-miR-497
    Publications New