Nasonia giraulti ngi-miR-277

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nasonia giraulti ngi-miR-277 URS00001B9842_7426

23 nucleotides
1 database (miRBase)
Found in 29 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAAAUGCACUAUCUGGUACGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

Acyrthosiphon pisum (pea aphid) api-miR-277
Aedes aegypti (yellow fever mosquito) Aae-Mir-277_3p (mature (guide))
Anopheles gambiae (African malaria mosquito) aga-miR-277
Apis mellifera (honey bee) ame-miR-277-3p
Blattella germanica Bge-Mir-277_3p (mature (guide))
Bombyx mori (domestic silkworm) bmo-miR-277-3p
Dinoponera quadriceps dqu-miR-277-3p
Drosophila ananassae dan-miR-277
Drosophila erecta der-miR-277
Drosophila grimshawi dgr-miR-277
Drosophila melanogaster (fruit fly) dme-miR-277-3p
Drosophila mojavensis dmo-miR-277
Drosophila persimilis dpe-miR-277
Drosophila pseudoobscura dps-miR-277
Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294385_df_nrg
Drosophila sechellia dse-miR-277
Drosophila simulans Dsi-Mir-277_3p (mature (guide))
Drosophila virilis dvi-miR-277-3p
Drosophila willistoni dwi-miR-277
Drosophila yakuba dya-miR-277
Eurosta solidaginis miR-277
Heliconius melpomene Hme-Mir-277_3p (mature (guide))
Manduca sexta (tobacco hornworm) mse-miR-277
Nasonia longicornis nlo-miR-277
Nasonia vitripennis (jewel wasp) nvi-miR-277
Plutella xylostella pxy-miR-277
Polistes canadensis pca-miR-277-3p
Spodoptera frugiperda (fall armyworm) sfr-miR-277-3p
Tribolium castaneum (red flour beetle) tca-miR-277-3p