Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anopheles gambiae (African malaria mosquito) aga-miR-277 URS00001B9842_7165

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aga-mir-277: Aga-mir-277 is a microRNA that is highly expressed in Anopheles gambiae [PMC5951587]. It is part of a group of microRNAs, including aga-miR-34, aga-miR-12, and aga-miR-283, that are preferentially expressed in the thorax of both male and female mosquitoes [PMC5951587]. These microRNAs are also expressed twice as much in the heads of mosquitoes [PMC5951587]. In female Anopheles gambiae, aga-miR-34 is more pronounced in the midguts, while aga-mir-277 is highly expressed in the midguts of males [PMC5951587]. Aga-mir-277 shows a clear sexual dimorphism and is predominantly expressed in the thorax [PMC2175301]. The expression patterns of microRNAs encoded in this cluster are complex [PMC2175301]. Changes were observed for aga-mir-277 and aga-miR-12 expression levels, with a ratio of 0.36 for aga-mir-277 and 2.80 for aga-miR-12 [PMC2175301]. References: [PMC5951587] - Biryukova I et al. (2018) The role of small RNA pathways during mosquito development and infection. Parasit Vectors 11(1): 159. [PMC2175301] - Biryukova I et al. (2008) MicroRNA cluster miR310–313 regulates male courtship behavior in Drosophila melanogaster. Nat Commun 9(1): 4619.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAUGCACUAUCUGGUACGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-277
  2. Aedes aegypti (yellow fever mosquito) Aae-Mir-277_3p (mature (guide))
  3. Apis mellifera (honey bee) ame-miR-277-3p
  4. Blattella germanica Bge-Mir-277_3p (mature (guide))
  5. Bombyx mori (domestic silkworm) bmo-miR-277-3p
  6. Dinoponera quadriceps dqu-miR-277-3p
  7. Drosophila ananassae dan-miR-277
  8. Drosophila erecta der-miR-277
  9. Drosophila grimshawi dgr-miR-277
  10. Drosophila melanogaster (fruit fly) dme-miR-277-3p
  11. Drosophila mojavensis dmo-miR-277
  12. Drosophila persimilis dpe-miR-277
  13. Drosophila pseudoobscura dps-miR-277
  14. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294385_df_nrg
  15. Drosophila sechellia dse-miR-277
  16. Drosophila simulans Dsi-Mir-277_3p (mature (guide))
  17. Drosophila virilis dvi-miR-277-3p
  18. Drosophila willistoni dwi-miR-277
  19. Drosophila yakuba dya-miR-277
  20. Eurosta solidaginis miR-277
  21. Heliconius melpomene Hme-Mir-277_3p (mature (guide))
  22. Manduca sexta (tobacco hornworm) mse-miR-277
  23. Nasonia giraulti ngi-miR-277
  24. Nasonia longicornis nlo-miR-277
  25. Nasonia vitripennis (jewel wasp) nvi-miR-277
  26. Plutella xylostella pxy-miR-277
  27. Polistes canadensis pca-miR-277-3p
  28. Spodoptera frugiperda (fall armyworm) sfr-miR-277-3p
  29. Tribolium castaneum (red flour beetle) tca-miR-277-3p
Publications