Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-277-3p URS00001B9842_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-277: Dme-mir-277 is a microRNA found in Drosophila melanogaster [PMC5459504]. Inhibition of dme-mir-277 using miRNA sponge constructs has been shown to increase endogenous muscle blind levels [PMC6888406]. Inhibition of dme-mir-277 resulted in a 15% reduction in IFM area compared to control flies [PMC5090246]. Silencing dme-mir-277 or dme-miR-304, another 3′UTR translation repressor, increased muscleblind levels and improved survival in DM1 flies [PMC5090246]. The silencing of dme-mir-277 or dme-miR-304 also resulted in changes to muscleblind subcellular localization and increased cytoplasmic Mbl levels [PMC5090246]. The binding sites of dme-mir-277 and dme-miR-304 overlap in the mblD 3′ UTR, which may explain the difference observed between in vivo and luciferase assays for mblD regulation by dme-mir-277 [PMC5090246]. Silencing of both microRNAs also rescued missplicing events associated with DM1 flies [PMC5090246]. The upregulation of muscleblind achieved by silencing these microRNAs has also been shown to reduce muscle atrophy and improve motor function and lifespan in DM1 flies [PMC5090246] [PMC6321436] [PMC8634727].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAUGCACUAUCUGGUACGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-277
  2. Aedes aegypti (yellow fever mosquito) Aae-Mir-277_3p (mature (guide))
  3. Anopheles gambiae (African malaria mosquito) aga-miR-277
  4. Apis mellifera (honey bee) ame-miR-277-3p
  5. Blattella germanica Bge-Mir-277_3p (mature (guide))
  6. Bombyx mori (domestic silkworm) bmo-miR-277-3p
  7. Dinoponera quadriceps dqu-miR-277-3p
  8. Drosophila ananassae dan-miR-277
  9. Drosophila erecta der-miR-277
  10. Drosophila grimshawi dgr-miR-277
  11. Drosophila mojavensis dmo-miR-277
  12. Drosophila persimilis dpe-miR-277
  13. Drosophila pseudoobscura dps-miR-277
  14. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294385_df_nrg
  15. Drosophila sechellia dse-miR-277
  16. Drosophila simulans Dsi-Mir-277_3p (mature (guide))
  17. Drosophila virilis dvi-miR-277-3p
  18. Drosophila willistoni dwi-miR-277
  19. Drosophila yakuba dya-miR-277
  20. Eurosta solidaginis miR-277
  21. Heliconius melpomene Hme-Mir-277_3p (mature (guide))
  22. Manduca sexta (tobacco hornworm) mse-miR-277
  23. Nasonia giraulti ngi-miR-277
  24. Nasonia longicornis nlo-miR-277
  25. Nasonia vitripennis (jewel wasp) nvi-miR-277
  26. Plutella xylostella pxy-miR-277
  27. Polistes canadensis pca-miR-277-3p
  28. Spodoptera frugiperda (fall armyworm) sfr-miR-277-3p
  29. Tribolium castaneum (red flour beetle) tca-miR-277-3p
Publications