Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila guanche tRNA.Asn secondary structure diagram

Drosophila guanche tRNA.Asn URS00001B18EA_7266

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUCCGUGGCGCAAUUGGUUAGCGCGUUCGGCUGUUAACCGAAAGGUUGGUGGUUCGAGUCCACCCGGGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Drosophila ananassae tRNA-Asn (GTT) (tRNA-Asn-GTT-1-1)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  6. Drosophila gunungcola tRNA-OTHER
  7. Drosophila melanogaster transfer RNA:Asparagine-GTT 1-8 (multiple genes)
  8. Drosophila persimilis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  9. Drosophila pseudoobscura pseudoobscura tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  10. Drosophila sechellia tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  11. Drosophila simulans tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  12. Drosophila yakuba tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  13. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014635.1
  14. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015014876.1
  15. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016384.1
  16. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016193.1
  17. Operophtera brumata tRNA
2D structure