v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Asparagine-GTT 1-8 (multiple genes) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Asparagine-GTT 1-8 (multiple genes) URS00001B18EA_7227

mRNA interactions total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUCCGUGGCGCAAUUGGUUAGCGCGUUCGGCUGUUAACCGAAAGGUUGGUGGUUCGAGUCCACCCGGGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Bradysia coprophila (Black fungus gnats) tRNA-Asn
  2. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015293.1
  3. Drosophila ananassae tRNA-Asn (GTT) (tRNA-Asn-GTT-1-1)
  4. Drosophila biarmipes (Fruit fly) transfer RNA asparagine (anticodon GUU)
  5. Drosophila busckii (Fruit fly) tRNA-Asn
  6. Drosophila elegans (Pomace flies) tRNA-Asn
  7. Drosophila erecta tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  8. Drosophila eugracilis (Fruit fly) tRNA-Asn
  9. Drosophila ficusphila (Fruit fly) tRNA-Asn
  10. Drosophila grimshawi tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  11. Drosophila guanche (Fruit fly) tRNA-Asn
  12. Drosophila gunungcola (Fruit fly) transfer RNA asparagine (anticodon GUU)
  13. Drosophila innubila (Fruit fly) tRNA-Asn
  14. Drosophila kikkawai (Pomace flies) transfer RNA asparagine (anticodon GUU)
  15. Drosophila mauritiana (Fruit fly) tRNA-Asn
  16. Drosophila miranda (Fruit fly) tRNA-Asn
  17. Drosophila montana (Pomace flies) transfer RNA asparagine (anticodon GUU)
  18. Drosophila obscura (Fruit fly) tRNA-Asn
  19. Drosophila persimilis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  20. Drosophila pseudoobscura (Fruit fly) tRNA-Asn
  21. Drosophila pseudoobscura pseudoobscura tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  22. Drosophila rhopaloa (Fruit fly) tRNA-Asn
  23. Drosophila santomea (Fruit fly) tRNA-Asn
  24. Drosophila sechellia tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  25. Drosophila simulans tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  26. Drosophila subobscura (Fruit fly) tRNA-Asn
  27. Drosophila subpulchrella (Fruit fly) tRNA-Asn
  28. Drosophila suzukii (Pomace flies) transfer RNA asparagine (anticodon GUU)
  29. Drosophila takahashii (Pomace flies) transfer RNA asparagine (anticodon GUU)
  30. Drosophila teissieri (Fruit fly) tRNA-Asn
  31. Drosophila yakuba tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  32. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014635.1
  33. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015014876.1
  34. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016384.1
  35. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016193.1
  36. Operophtera brumata tRNA
  37. Pycnogonum litorale transfer RNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications