Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016384.1 secondary structure diagram

Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016384.1 URS00001B18EA_1271730

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUCCGUGGCGCAAUUGGUUAGCGCGUUCGGCUGUUAACCGAAAGGUUGGUGGUUCGAGUCCACCCGGGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Bradysia coprophila (Black fungus gnats) tRNA-Asn
  2. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015293.1
  3. Drosophila ananassae tRNA-Asn (GTT) (tRNA-Asn-GTT-1-1)
  4. Drosophila biarmipes (Fruit fly) transfer RNA asparagine (anticodon GUU)
  5. Drosophila busckii (Fruit fly) tRNA-Asn
  6. Drosophila elegans (Pomace flies) tRNA-Asn
  7. Drosophila erecta tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 7)
  8. Drosophila eugracilis (Fruit fly) tRNA-Asn
  9. Drosophila ficusphila (Fruit fly) tRNA-Asn
  10. Drosophila grimshawi tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  11. Drosophila guanche (Fruit fly) tRNA-Asn
  12. Drosophila gunungcola (Fruit fly) transfer RNA asparagine (anticodon GUU)
  13. Drosophila innubila (Fruit fly) tRNA-Asn
  14. Drosophila kikkawai (Pomace flies) transfer RNA asparagine (anticodon GUU)
  15. Drosophila mauritiana (Fruit fly) tRNA-Asn
  16. Drosophila melanogaster transfer RNA:Asparagine-GTT 1-8 (multiple genes)
  17. Drosophila miranda (Fruit fly) tRNA-Asn
  18. Drosophila montana (Pomace flies) transfer RNA asparagine (anticodon GUU)
  19. Drosophila obscura (Fruit fly) tRNA-Asn
  20. Drosophila persimilis tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  21. Drosophila pseudoobscura (Fruit fly) tRNA-Asn
  22. Drosophila pseudoobscura pseudoobscura tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  23. Drosophila rhopaloa (Fruit fly) tRNA-Asn
  24. Drosophila santomea (Fruit fly) tRNA-Asn
  25. Drosophila sechellia tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  26. Drosophila simulans tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  27. Drosophila subobscura (Fruit fly) tRNA-Asn
  28. Drosophila subpulchrella (Fruit fly) tRNA-Asn
  29. Drosophila suzukii (Pomace flies) transfer RNA asparagine (anticodon GUU)
  30. Drosophila takahashii (Pomace flies) transfer RNA asparagine (anticodon GUU)
  31. Drosophila teissieri (Fruit fly) tRNA-Asn
  32. Drosophila yakuba tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  33. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014635.1
  34. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015014876.1
  35. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016193.1
  36. Operophtera brumata tRNA
  37. Pycnogonum litorale transfer RNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...