v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-26a URS000019B0F7_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-miR-26a: Cfa-mir-26a is a microRNA that has been studied in various contexts. It was selected for validation in microarray results along with other microRNAs [PMC5678797]. In veterinary patients, changes in the concentration of cfa-mir-26a have been observed in canine ventricular and atrial muscles after the development of congestive heart failure [PMC5533140]. Additionally, cfa-mir-26a has been found to be highly expressed in the epididymis of mature dogs compared to immature dogs [PMC10135127]. The expression of cfa-mir-26a, along with other microRNAs, is affected by age in the epididymis of dogs [PMC10135127]. It has been suggested that cfa-mir-26a, along with other microRNAs, may be involved in aging in dogs [PMC10135127]. In adrenal cortex samples, cfa-mir-26a is part of the miRNA families that are most abundant and active [PMC4768678]. Furthermore, cfa-mir-26a has shown significant differential expression between metastatic and non-metastatic mammary tumors [PMC7646326]. Lastly, cfa-mir-26a has been identified as being unique to a specific comparison among various miRNAs [PMC9617701].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCAAGUAAUCCAGGAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Alligator mississippiensis ami-miR-26-5p
  2. Anolis carolinensis (green anole) aca-miR-26-3-5p
  3. Bos taurus bta-miR-26a
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26a
  5. Callorhinchus milii Cmi-Mir-26-P1_5p (mature (guide))
  6. Capra hircus (goat) chi-miR-26a-5p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
  8. Cervus elaphus cel-miR-26a
  9. Chiloscyllium plagiosum microRNA cpl-miR-26
  10. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-26-5p
  12. Columba livia (rock pigeon) cli-miR-26-5p
  13. Cyprinus carpio (common carp) ccr-miR-26a
  14. Danio rerio (zebrafish) dre-miR-26a-5p
  15. Dasypus novemcinctus dno-miR-26a-5p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-26a
  17. Echinops telfairi Ete-Mir-26-P1_5p (mature (guide))
  18. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P5_5p (mature (guide))
  19. Equus caballus eca-miR-26a
  20. Gadus morhua gmo-miR-26a-5p
  21. Gallus gallus (chicken) gga-miR-26a-2-5p
  22. Gekko japonicus Gja-Mir-26-P1_5p (mature (guide))
  23. Gorilla gorilla gorilla ggo-miR-26a (MIR26A)
  24. Gorilla gorilla (western gorilla) ggo-miR-26a
  25. Haplochromis burtoni abu-miR-26a
  26. Homo sapiens hsa-miR-26a-5p
  27. Ictalurus punctatus (channel catfish) ipu-miR-26a
  28. Lagothrix lagotricha (brown woolly monkey) lla-miR-26a
  29. Latimeria chalumnae Lch-Mir-26-P4_5p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Mir-26-P1_5p (mature (guide))
  31. Macaca mulatta (Rhesus monkey) mml-miR-26a-5p
  32. Macaca nemestrina mne-miR-26a
  33. Maylandia zebra (zebra mbuna) mze-miR-26a
  34. Microcaecilia unicolor Mun-Mir-26-P4_5p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-miR-26a
  36. Monodelphis domestica Mdo-Mir-26-P1_5p (mature (guide))
  37. Monopterus albus Mal-Mir-26-P1b_5p (mature (guide))
  38. Mus musculus mmu-miR-26a-5p
  39. Neolamprologus brichardi (lyretail cichlid) nbr-miR-26a
  40. Nomascus leucogenys nle-miR-26a
  41. Ophiophagus hannah oha-miR-26-5p
  42. Oreochromis niloticus (Nile tilapia) oni-miR-26a
  43. Ornithorhynchus anatinus (platypus) oan-miR-26-5p
  44. Oryctolagus cuniculus (rabbit) ocu-miR-26a-5p
  45. Otolemur garnettii (small-eared galago) oga-miR-26a
  46. Ovis aries (sheep) oar-miR-26a
  47. Pan paniscus ppa-miR-26a
  48. Pan troglodytes ptr-miR-26a
  49. Papio hamadryas pha-miR-26a
  50. Petromyzon marinus pma-miR-26a-5p
  51. Pongo pygmaeus (Bornean orangutan) ppy-miR-26a
  52. Pteropus alecto (black flying fox) pal-miR-26a-5p
  53. Pundamilia nyererei pny-miR-26a
  54. Python bivittatus (Burmese python) pbv-miR-26-5p
  55. Rattus norvegicus rno-miR-26a-5p
  56. Saimiri boliviensis boliviensis sbo-miR-26a
  57. Salmo salar ssa-miR-26a-5p
  58. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-26-P1_5p (mature (guide))
  59. Scyliorhinus torazame (cloudy catshark) Sto-Mir-26-P1_5p (mature (guide))
  60. Sphenodon punctatus (tuatara) Spt-Mir-26-P1_5p (mature (guide))
  61. Sus scrofa ssc-miR-26a
  62. Taeniopygia guttata (zebra finch) tgu-miR-26-5p
  63. Takifugu rubripes fru-miR-26
  64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-26
  65. Tor tambroides miR-26a-5p
  66. Tupaia chinensis (Chinese tree shrew) tch-miR-26a-5p
  67. Xenopus laevis xla-miR-26-5p
  68. Xenopus tropicalis Xtr-Mir-26-P1_5p (mature (guide))
 Publications