Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-26a URS000019B0F7_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-26a: Oar-mir-26a is a differentially expressed miRNA that has been studied in various contexts. It has been verified by q-PCR in a study that examined differentially expressed miRNAs in the infarcted area and infarct boundary area [PMC5611885]. The expression of oar-mir-26a was found to be upregulated in the infarct boundary area [PMC5611885]. Additionally, oar-mir-26a was found to be significantly differentially expressed between the unloading group and control group [PMC5611885]. Functional annotations and pathway enrichment analysis revealed that oar-mir-26a is involved in reentry into the mitotic cell cycle, leukocyte mediated immunity, gap junction channel activity, and several signaling pathways including Lysosome, Jak-STAT signaling pathway, and adrenergic signaling in cardiomyocytes [PMC5611885]. It has also been identified as one of the top 20 immune-related miRNAs in sheep [PMC7070426]. Furthermore, oar-mir-26a has been shown to have higher expression levels compared to other miRNAs such as oar-miR-10b and novel-miR-31 under certain conditions [PMC4401794] [PMC4440528]. It has also been used as a normalizer miRNA for gene expression analysis in sheep tissues due to its consistent amplification across samples [PMC5709059]. Additionally, it has been implicated as a target of LOC105611671 lncRNA for regulating FGF9 expression and promoting testicular steroidogenesis in Hu sheep Leydig cells [PMC9940382] [PMC9219891]. Oar-mir-26a along with Oar-miR-181a and Oar-miR-143 have shown higher levels of expression during the breeding season [PMC7992348].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Alligator mississippiensis ami-miR-26-5p
  2. Anolis carolinensis (green anole) aca-miR-26-3-5p
  3. Bos taurus bta-miR-26a
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26a
  5. Callorhinchus milii Cmi-Mir-26-P1_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-26a
  7. Capra hircus (goat) chi-miR-26a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
  9. Cervus elaphus cel-miR-26a
  10. Chiloscyllium plagiosum microRNA cpl-miR-26
  11. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-26-5p
  13. Columba livia (rock pigeon) cli-miR-26-5p
  14. Cyprinus carpio (common carp) ccr-miR-26a
  15. Danio rerio (zebrafish) dre-miR-26a-5p
  16. Dasypus novemcinctus dno-miR-26a-5p
  17. Daubentonia madagascariensis (aye-aye) dma-miR-26a
  18. Echinops telfairi Ete-Mir-26-P1_5p (mature (guide))
  19. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P5_5p (mature (guide))
  20. Equus caballus eca-miR-26a
  21. Gadus morhua gmo-miR-26a-5p
  22. Gallus gallus (chicken) gga-miR-26a-2-5p
  23. Gekko japonicus Gja-Mir-26-P1_5p (mature (guide))
  24. Gorilla gorilla gorilla ggo-miR-26a (MIR26A)
  25. Gorilla gorilla (western gorilla) ggo-miR-26a
  26. Haplochromis burtoni abu-miR-26a
  27. Homo sapiens hsa-miR-26a-5p
  28. Ictalurus punctatus (channel catfish) ipu-miR-26a
  29. Lagothrix lagotricha (brown woolly monkey) lla-miR-26a
  30. Latimeria chalumnae Lch-Mir-26-P4_5p (mature (guide))
  31. Lepisosteus oculatus (spotted gar) Loc-Mir-26-P1_5p (mature (guide))
  32. Macaca mulatta (Rhesus monkey) mml-miR-26a-5p
  33. Macaca nemestrina mne-miR-26a
  34. Maylandia zebra (zebra mbuna) mze-miR-26a
  35. Microcaecilia unicolor Mun-Mir-26-P4_5p (mature (guide))
  36. Microcebus murinus (gray mouse lemur) mmr-miR-26a
  37. Monodelphis domestica Mdo-Mir-26-P1_5p (mature (guide))
  38. Monopterus albus Mal-Mir-26-P1b_5p (mature (guide))
  39. Mus musculus mmu-miR-26a-5p
  40. Neolamprologus brichardi (lyretail cichlid) nbr-miR-26a
  41. Nomascus leucogenys nle-miR-26a
  42. Ophiophagus hannah oha-miR-26-5p
  43. Oreochromis niloticus (Nile tilapia) oni-miR-26a
  44. Ornithorhynchus anatinus (platypus) oan-miR-26-5p
  45. Oryctolagus cuniculus (rabbit) ocu-miR-26a-5p
  46. Otolemur garnettii (small-eared galago) oga-miR-26a
  47. Pan paniscus ppa-miR-26a
  48. Pan troglodytes ptr-miR-26a
  49. Papio hamadryas pha-miR-26a
  50. Petromyzon marinus pma-miR-26a-5p
  51. Pongo pygmaeus (Bornean orangutan) ppy-miR-26a
  52. Pteropus alecto (black flying fox) pal-miR-26a-5p
  53. Pundamilia nyererei pny-miR-26a
  54. Python bivittatus (Burmese python) pbv-miR-26-5p
  55. Rattus norvegicus rno-miR-26a-5p
  56. Saimiri boliviensis boliviensis sbo-miR-26a
  57. Salmo salar ssa-miR-26a-5p
  58. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-26-P1_5p (mature (guide))
  59. Scyliorhinus torazame (cloudy catshark) Sto-Mir-26-P1_5p (mature (guide))
  60. Sphenodon punctatus (tuatara) Spt-Mir-26-P1_5p (mature (guide))
  61. Sus scrofa ssc-miR-26a
  62. Taeniopygia guttata (zebra finch) tgu-miR-26-5p
  63. Takifugu rubripes fru-miR-26
  64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-26
  65. Tor tambroides miR-26a-5p
  66. Tupaia chinensis (Chinese tree shrew) tch-miR-26a-5p
  67. Xenopus laevis xla-miR-26-5p
  68. Xenopus tropicalis Xtr-Mir-26-P1_5p (mature (guide))
Publications