Canis lupus familiaris (dog) cfa-miR-33a URS00001815EE_9615

• 20 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 10 other species
• 139 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GUGCAUUGUAGUUGCAUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Callithrix jacchus cja-miR-33
2. Callorhinchus milii (elephant shark) eshark_mir-33_1
3. Capra hircus (goat) chi-miR-33a-5p
4. Cervus elaphus (red deer) cel-miR-33a
5. Cricetulus griseus cgr-miR-33
6. Eptesicus fuscus efu-miR-33
7. Gallus gallus (chicken) gga-miR-33-5p
8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8137712
9. Scyliorhinus torazame Sto-Mir-33-P3_5p (mature (guide))
10. Taeniopygia guttata (zebra finch) tgu-miR-33-5p

Publications Download

• FASTA
• JSON