v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-33a URS00001815EE_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGCAUUGUAGUUGCAUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus cja-miR-33
  2. Callorhinchus milii (elephant shark) eshark_mir-33_1
  3. Canis lupus familiaris (dog) cfa-miR-33a
  4. Capra hircus (goat) chi-miR-33a-5p
  5. Cricetulus griseus cgr-miR-33
  6. Eptesicus fuscus efu-miR-33
  7. Gallus gallus (chicken) gga-miR-33-5p
  8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8137712
  9. Scyliorhinus torazame Sto-Mir-33-P3_5p (mature (guide))
  10. Taeniopygia guttata (zebra finch) tgu-miR-33-5p