Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-299a-5p URS000017DBB8_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUUUACCGUCCCACAUACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-299
  2. Canis lupus familiaris (dog) cfa-miR-299
  3. Cervus elaphus (red deer) cel-miR-299
  4. Dasypus novemcinctus Dno-Mir-154-P2-v2_5p (mature (co-guide))
  5. Homo sapiens (human) hsa-miR-299-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-299-5p
  7. Mus musculus (house mouse) mmu-miR-299a-5p
  8. Ovis aries oar-miR-299-5p
  9. Pan troglodytes (chimpanzee) ptr-miR-299
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-299-5p
  11. Pteropus alecto pal-miR-299a-5p
Publications