Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-299-5p URS000017DBB8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-299: Hsa-mir-299 is a microRNA that has been identified in various studies to be associated with estrogen signaling [PMC4206873]. It is part of a predictive signature that includes other miRNAs such as hsa-miR-135b, hsa-miR-190, hsa-miR-217, hsa-miR-218, and hsa-miR-342 [PMC5123339]. Hsa-mir-299 and its variants have also been found to be associated with esophageal neoplasms [PMC9483142]. It has been shown to bind to hsa_circ_0065898 and play roles in various diseases [PMC8797878]. The expression of hsa-mir-299 has been associated with poor prognosis in certain diseases [PMC8797878]. In research studies, the expression of hsa-mir-299 has been manipulated using constructs such as pIRES2-EGFP and pMIR-Report vector [PMC3829031]. Hsa-mir-299 has also been found to have different roles in different diseases, acting as a tumor suppressor in hepatocellular carcinoma (HCC) but associated with poor prognosis in esophageal carcinoma (EC) patients [PMC7467934] [PMC9200351]. It is also involved in the suppression of key target genes associated with HCV-host interactions and may have potential targets such as ATG5, PRKAA1, MYCN, ITGB3BP, and PDGFRbeta [PMC8615810]. Furthermore, it has been predicted to target genes related to Alzheimer's disease (AD) based on microRNA-target analysis studies [PMC9312389]. The expression of hsa-mir-299 is specific to adenomas and advanced carcinoma but not expressed in AEC (adenocarcinoma) cells [PMC7764749].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUUUACCGUCCCACAUACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus bta-miR-299
  2. Canis lupus familiaris (dog) cfa-miR-299
  3. Cervus elaphus cel-miR-299
  4. Dasypus novemcinctus Dno-Mir-154-P2-v2_5p (mature (co-guide))
  5. Macaca mulatta mml-miR-299-5p
  6. Mus musculus mmu-miR-299a-5p
  7. Ovis aries (sheep) oar-miR-299-5p
  8. Pan troglodytes ptr-miR-299
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-299-5p
  10. Pteropus alecto pal-miR-299a-5p
  11. Rattus norvegicus rno-miR-299a-5p
Publications