Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-299-5p URS000017DBB8_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUUUACCGUCCCACAUACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus bta-miR-299
  2. Canis lupus familiaris (dog) cfa-miR-299
  3. Cervus elaphus cel-miR-299
  4. Dasypus novemcinctus Dno-Mir-154-P2-v2_5p (mature (co-guide))
  5. Homo sapiens hsa-miR-299-5p
  6. Mus musculus mmu-miR-299a-5p
  7. Ovis aries (sheep) oar-miR-299-5p
  8. Pan troglodytes ptr-miR-299
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-299-5p
  10. Pteropus alecto pal-miR-299a-5p
  11. Rattus norvegicus rno-miR-299a-5p
Publications