Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-221-3p URS0000170CF4_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-221: Gga-mir-221 is a microRNA that was transfected into DF-1 cells along with gga-miR-222 and a negative control mimic using X-tremeGENE siRNA Transfection Reagent [PMC4690879]. The study found that gga-mir-221 and gga-miR-222 were up-regulated in the livers of pullets infected with ALV-J [PMC4690879].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUUGUCUGCUGGGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-221-3p
  2. Anolis carolinensis Aca-Mir-221-P2a_3p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-221-P2a_3p (mature (guide))
  4. Canis lupus familiaris Cfa-Mir-221-P2a_3p (mature (guide))
  5. Capra hircus (goat) miR-221
  6. Cavia porcellus cpo-miR-221-3p
  7. Cervus elaphus (red deer) cel-miR-221
  8. Columba livia Cli-Mir-221-P2a_3p (mature (guide))
  9. Cricetulus griseus (Chinese hamster) cgr-miR-221-3p
  10. Danio rerio dre-miR-221-3p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
  12. Daubentonia madagascariensis dma-miR-221
  13. Echinops telfairi Ete-Mir-221-P2a_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-221
  15. Gadus morhua (Atlantic cod) Gmo-Mir-221-P2a1_3p (mature (guide))
  16. Gekko japonicus Gja-Mir-221-P2a_3p (mature (guide))
  17. Gorilla gorilla gorilla ggo-miR-221 (MIR221)
  18. Gorilla gorilla ggo-miR-221
  19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
  20. Homo sapiens (human) hsa-miR-221-3p
  21. Latimeria chalumnae Lch-Mir-221-P2a_3p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-221-P2a_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-221-3p
  24. Maylandia zebra (zebra mbuna) mze-miR-221
  25. Microcebus murinus mmr-miR-221
  26. Monodelphis domestica (gray short-tailed opossum) mdo-miR-221-3p
  27. Monopterus albus Mal-Mir-221-P2a1_3p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-221-3p
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-221
  30. Nomascus leucogenys nle-miR-221
  31. Ophiophagus hannah (king cobra) oha-miR-221-3p
  32. Oreochromis niloticus oni-miR-221
  33. Oryctolagus cuniculus ocu-miR-221-3p
  34. Oryzias latipes ola-miR-221
  35. Otolemur garnettii (small-eared galago) oga-miR-221
  36. Ovis aries miscellaneous RNA
  37. Pan paniscus ppa-miR-221
  38. Pan troglodytes ptr-miR-221
  39. Papio hamadryas (hamadryas baboon) pha-miR-221
  40. Pongo pygmaeus ppy-miR-221
  41. Pundamilia nyererei pny-miR-221
  42. Rattus norvegicus rno-miR-221-3p
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-221-P2a_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-221-P2a_3p (mature (guide))
  46. Taeniopygia guttata tgu-miR-221-3p
  47. Takifugu rubripes (torafugu) fru-miR-221
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-221
  49. Tor tambroides (Thai mahseer) miR-221-3p
  50. Xenopus laevis Xla-Mir-221-P2a4_3p (mature (guide))
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-221
Publications