Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-221-3p URS0000170CF4_9031

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Gallus gallus. Annotated by 5 databases (ENA, RefSeq, PirBase, miRBase, MirGeneDB). Gallus gallus (chicken) gga-miR-221-3p sequence is a product of MIR221, gga-miR-221-3p, miR-221, miR-221-3p, gga-miR-221 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUACAUUGUCUGCUGGGUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 50 other species

    1. Alligator mississippiensis ami-miR-221-3p
    2. Anolis carolinensis (green anole) Aca-Mir-221-P2a_3p (mature (guide))
    3. Bos taurus Bta-Mir-221-P2a_3p (mature (guide))
    4. Canis lupus familiaris Cfa-Mir-221-P2a_3p (mature (guide))
    5. Capra hircus (goat) miR-221
    6. Cavia porcellus (domestic guinea pig) cpo-miR-221-3p
    7. Cervus elaphus cel-miR-221
    8. Chrysemys picta bellii Cpi-Mir-221-P1_3p* (star (passenger))
    9. Columba livia Cli-Mir-221-P2a_3p (mature (guide))
    10. Cricetulus griseus (Chinese hamster) cgr-miR-221-3p
    11. Danio rerio dre-miR-221-3p
    12. Dasypus novemcinctus dno-miR-221-3p
    13. Daubentonia madagascariensis (aye-aye) dma-miR-221
    14. Echinops telfairi Ete-Mir-221-P2a_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-221
    16. Gadus morhua Gmo-Mir-221-P2a1_3p (mature (guide))
    17. Gekko japonicus Gja-Mir-221-P2a_3p (mature (guide))
    18. Gorilla gorilla (western gorilla) ggo-miR-221
    19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
    20. Homo sapiens hsa-miR-221-3p
    21. Latimeria chalumnae (coelacanth) Lch-Mir-221-P2a_3p (mature (guide))
    22. Lepisosteus oculatus (spotted gar) Loc-Mir-221-P2a_3p (mature (guide))
    23. Macaca mulatta mml-miR-221-3p
    24. Maylandia zebra (zebra mbuna) mze-miR-221
    25. Microcebus murinus (gray mouse lemur) mmr-miR-221
    26. Monodelphis domestica (gray short-tailed opossum) mdo-miR-221-3p
    27. Monopterus albus (swamp eel) Mal-Mir-221-P2a1_3p (mature (guide))
    28. Mus musculus mmu-miR-221-3p
    29. Neolamprologus brichardi nbr-miR-221
    30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-221
    31. Ophiophagus hannah oha-miR-221-3p
    32. Oreochromis niloticus oni-miR-221
    33. Ornithorhynchus anatinus Oan-Mir-221-P1_3p* (star (passenger))
    34. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
    35. Oryzias latipes ola-miR-221
    36. Otolemur garnettii oga-miR-221
    37. Ovis aries (sheep) miscellaneous RNA
    38. Pan paniscus ppa-miR-221
    39. Pan troglodytes ptr-miR-221
    40. Papio hamadryas pha-miR-221
    41. Pongo pygmaeus ppy-miR-221
    42. Pundamilia nyererei pny-miR-221
    43. Rattus norvegicus (Norway rat) rno-miR-221-3p
    44. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
    45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-221-P2a_3p (mature (guide))
    46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1_3p* (star (passenger))
    47. Sphenodon punctatus (tuatara) Spt-Mir-221-P2a_3p (mature (guide))
    48. Taeniopygia guttata tgu-miR-221-3p
    49. Takifugu rubripes fru-miR-221
    50. Tetraodon nigroviridis tni-miR-221
    51. Tor tambroides (Thai mahseer) miR-221-3p
    52. Xenopus laevis Xla-Mir-221-P2a4_3p (mature (guide))
    53. Xenopus tropicalis xtr-miR-221
    Publications New