Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-221-3p URS0000170CF4_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 8 databases (PSICQUIC, RefSeq, LncBase, MirGeneDB, miRBase, PirBase, ENA, TarBase). Described in 44 papers. Mus musculus (house mouse) mmu-miR-221-3p sequence is a product of miR-221-3p, mmu-miR-221-3p, miR-221, Mir221, mmu-miR-221 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610009M14Rik, 0610009N12Rik, 0610010I05Rik, 0610010I12Rik, 0610010K06Rik, 0610013E23Rik, 0610025N14Rik, 0610030E20Rik, 0610033L19Rik.

Interactions 14

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-221-3p interacts with:

Interaction id Participant Synonyms
URS0000170CF4_10090-7 O54918 O54918
URS0000170CF4_10090-0 O54918 O54918
URS0000170CF4_10090-1 P15037 P15037
URS0000170CF4_10090-8 P15037 P15037
URS0000170CF4_10090-9 P23906 P23906
URS0000170CF4_10090-2 P23906 P23906
URS0000170CF4_10090-10 P27577 P27577
URS0000170CF4_10090-3 P27577 P27577
URS0000170CF4_10090-11 P40224 P40224
URS0000170CF4_10090-4 P40224 P40224
URS0000170CF4_10090-5 Q66JW3 Q66JW3
URS0000170CF4_10090-12 Q66JW3 Q66JW3
URS0000170CF4_10090-13 Q91ZE9 Q91ZE9
URS0000170CF4_10090-6 Q91ZE9 Q91ZE9

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUACAUUGUCUGCUGGGUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Alligator mississippiensis ami-miR-221-3p
    2. Anolis carolinensis Aca-Mir-221-P1_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-221-P1_3p (mature (guide))
    4. Canis lupus familiaris Cfa-Mir-221-P1_3p (mature (guide))
    5. Capra hircus miR-221
    6. Cavia porcellus (domestic guinea pig) cpo-miR-221-3p
    7. Cervus elaphus (red deer) cel-miR-221
    8. Chrysemys picta bellii Cpi-Mir-221-P1_3p* (star (passenger))
    9. Columba livia (rock pigeon) Cli-Mir-221-P1_3p (mature (guide))
    10. Cricetulus griseus cgr-miR-221-3p
    11. Danio rerio (zebrafish) dre-miR-221-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
    13. Daubentonia madagascariensis (aye-aye) dma-miR-221
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P1_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-221
    16. Gallus gallus (chicken) gga-miR-221-3p
    17. Gorilla gorilla (western gorilla) ggo-miR-221
    18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
    19. Homo sapiens hsa-miR-221-3p
    20. Macaca mulatta mml-miR-221-3p
    21. Maylandia zebra mze-miR-221
    22. Microcebus murinus mmr-miR-221
    23. Monodelphis domestica mdo-miR-221-3p
    24. Neolamprologus brichardi nbr-miR-221
    25. Nomascus leucogenys nle-miR-221
    26. Ophiophagus hannah oha-miR-221-3p
    27. Oreochromis niloticus oni-miR-221
    28. Ornithorhynchus anatinus Oan-Mir-221-P1_3p* (star (passenger))
    29. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
    30. Oryzias latipes (Japanese medaka) ola-miR-221
    31. Otolemur garnettii oga-miR-221
    32. Ovis aries miscellaneous RNA
    33. Pan paniscus ppa-miR-221
    34. Pan troglodytes (chimpanzee) ptr-miR-221
    35. Papio hamadryas (hamadryas baboon) pha-miR-221
    36. Pongo pygmaeus ppy-miR-221
    37. Pundamilia nyererei pny-miR-221
    38. Rattus norvegicus rno-miR-221-3p
    39. Saimiri boliviensis boliviensis sbo-miR-221
    40. Sarcophilus harrisii Sha-Mir-221-P1_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1_3p* (star (passenger))
    42. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
    43. Takifugu rubripes (torafugu) fru-miR-221
    44. Tetraodon nigroviridis tni-miR-221
    45. Tor tambroides miR-221-3p
    46. Xenopus tropicalis xtr-miR-221