Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-96-5p URS000016FF9C_9606

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCACUAGCACAUUUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-96-5p
  2. Bos taurus bta-miR-96
  3. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-96-5p
  4. Branchiostoma floridae (Florida lancelet) bfl-miR-96-5p
  5. Branchiostoma lanceolatum Bla-Mir-96-P1_5p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-96
  7. Callorhinchus milii Cmi-Mir-96-P1_5p (mature (guide))
  8. Canis lupus familiaris cfa-miR-96
  9. Cavia porcellus cpo-miR-96-5p
  10. Cervus elaphus cel-miR-96
  11. Chrysemys picta bellii Cpi-Mir-96-P1_5p (mature (guide))
  12. Columba livia (rock pigeon) cli-miR-96-5p
  13. Cyprinus carpio ccr-miR-96
  14. Danio rerio (zebrafish) dre-miR-96-5p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-96-5p
  16. Echinops telfairi Ete-Mir-96-P1_5p (mature (guide))
  17. Equus caballus eca-miR-96
  18. Gadus morhua (Atlantic cod) gmo-miR-96-5p
  19. Gallus gallus (chicken) Gga-Mir-96-P1_5p (mature (guide))
  20. Gekko japonicus Gja-Mir-96-P1_5p (mature (guide))
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-96
  22. Ictalurus punctatus (channel catfish) ipu-miR-96
  23. Latimeria chalumnae Lch-Mir-96-P1_5p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-96-P1_5p (mature (guide))
  25. Macaca mulatta Mml-Mir-96-P1_5p (mature (guide))
  26. Maylandia zebra (zebra mbuna) mze-miR-96
  27. Microcaecilia unicolor Mun-Mir-96-P1_5p (mature (guide))
  28. Monodelphis domestica (gray short-tailed opossum) mdo-miR-96
  29. Monopterus albus Mal-Mir-96-P1b_5p (mature (guide))
  30. Mus musculus (house mouse) mmu-miR-96-5p
  31. Neolamprologus brichardi nbr-miR-96
  32. Ophiophagus hannah oha-miR-96
  33. Oreochromis niloticus oni-miR-96
  34. Ornithorhynchus anatinus oan-miR-96-5p
  35. Oryctolagus cuniculus ocu-miR-96-5p
  36. Pongo pygmaeus (Bornean orangutan) ppy-miR-96
  37. Pteropus alecto pal-miR-96-5p
  38. Pundamilia nyererei pny-miR-96
  39. Python bivittatus (Burmese python) pbv-miR-96-5p
  40. Rattus norvegicus (Norway rat) rno-miR-96-5p
  41. Salmo salar ssa-miR-96-5p
  42. Sarcophilus harrisii Sha-Mir-96-P1_5p (mature (guide))
  43. Scyliorhinus torazame Sto-Mir-96-P1_5p (mature (guide))
  44. Sphenodon punctatus (tuatara) Spt-Mir-96-P1_5p (mature (guide))
  45. Sus scrofa ssc-miR-96-5p
  46. Taeniopygia guttata (zebra finch) Tgu-Mir-96-P1_5p (mature (guide))
  47. Takifugu rubripes fru-miR-96
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-96
  49. Tor tambroides miR-96-5p
  50. Xenopus laevis xla-miR-96-5p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-96
Publications