Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-96 URS000016FF9C_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-96: Bta-mir-96 is a microRNA that has been studied in various contexts. It has been found to show a strong correlation with more than half of the genera, along with other microRNAs such as bta-miR-652, bta-miR-18a, and bta-miR-6123 [PMC9378797]. Bta-mir-96 has been shown to potentially influence milk yield and protein percentage by targeting TP53 [PMC6164576]. It is also associated with milk yield and milk components in response to dietary supplementation [PMC6164576]. Bta-mir-96, along with other microRNAs such as bta-miR-196a, bta-miR-182, and bta-miR-183, has been found to be expressed significantly higher in certain groups compared to others [PMC9940382]. Bta-mir-96 is one of the top upregulated microRNAs within its cluster [PMC5505194]. It is also one of the differentially expressed microRNAs in various comparisons [PMC10000098]. Bta-mir-96 is a member of the miR-183 cluster that is highly enriched in granulosa cells of preovulatory dominant follicles [PMC4438052]. It has been shown to target the Forkhead box protein O1 (FOXO1) gene along with other miRNAs from its cluster [PMC4438052]. Additionally, it may be involved in modulating the ErbB gene family during bovine follicular development [PMC4438052]. Overall, bta-mir-96 plays a role in various biological processes and may have implications for milk production and follicular development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCACUAGCACAUUUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-96-5p
  2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-96-5p
  3. Branchiostoma floridae bfl-miR-96-5p
  4. Branchiostoma lanceolatum (amphioxus) Bla-Mir-96-P1_5p (mature (guide))
  5. Callithrix jacchus cja-miR-96
  6. Callorhinchus milii Cmi-Mir-96-P1_5p (mature (guide))
  7. Canis lupus familiaris cfa-miR-96
  8. Cavia porcellus cpo-miR-96-5p
  9. Cervus elaphus (red deer) cel-miR-96
  10. Chrysemys picta bellii Cpi-Mir-96-P1_5p (mature (guide))
  11. Columba livia cli-miR-96-5p
  12. Cyprinus carpio ccr-miR-96
  13. Danio rerio dre-miR-96-5p
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-96-5p
  15. Echinops telfairi Ete-Mir-96-P1_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-96
  17. Gadus morhua (Atlantic cod) gmo-miR-96-5p
  18. Gallus gallus (chicken) Gga-Mir-96-P1_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-96-P1_5p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-96
  21. Homo sapiens (human) hsa-miR-96-5p
  22. Ictalurus punctatus ipu-miR-96
  23. Latimeria chalumnae Lch-Mir-96-P1_5p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-96-P1_5p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) Mml-Mir-96-P1_5p (mature (guide))
  26. Maylandia zebra (zebra mbuna) mze-miR-96
  27. Microcaecilia unicolor Mun-Mir-96-P1_5p (mature (guide))
  28. Monodelphis domestica (gray short-tailed opossum) mdo-miR-96
  29. Monopterus albus Mal-Mir-96-P1b_5p (mature (guide))
  30. Mus musculus (house mouse) mmu-miR-96-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-96
  32. Ophiophagus hannah (king cobra) oha-miR-96
  33. Oreochromis niloticus oni-miR-96
  34. Ornithorhynchus anatinus (platypus) oan-miR-96-5p
  35. Oryctolagus cuniculus ocu-miR-96-5p
  36. Pongo pygmaeus ppy-miR-96
  37. Pteropus alecto (black flying fox) pal-miR-96-5p
  38. Pundamilia nyererei pny-miR-96
  39. Python bivittatus pbv-miR-96-5p
  40. Rattus norvegicus rno-miR-96-5p
  41. Salmo salar ssa-miR-96-5p
  42. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-96-P1_5p (mature (guide))
  43. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P1_5p (mature (guide))
  44. Sphenodon punctatus (tuatara) Spt-Mir-96-P1_5p (mature (guide))
  45. Sus scrofa ssc-miR-96-5p
  46. Taeniopygia guttata Tgu-Mir-96-P1_5p (mature (guide))
  47. Takifugu rubripes (torafugu) fru-miR-96
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-96
  49. Tor tambroides (Thai mahseer) miR-96-5p
  50. Xenopus laevis xla-miR-96-5p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-96
Publications