Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-96 URS000016FF9C_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-96: Cfa-mir-96 is an oncogenic miRNA that has been found to be highly conserved in both dogs and humans [PMC6827104]. In a study on canine mammary tumors (CMTs), it was observed that the expression of cfa-mir-96 was significantly increased in these tumors, which is consistent with its promoter hypomethylation [PMC6827104]. On the other hand, cfa-miR-149, a tumor-suppressive miRNA, showed decreased expression in CMTs, which is in line with its promoter hypermethylation [PMC6827104]. Among the top five predicted target genes of cfa-mir-96, three genes (BRPF3, ADCY6, and LRIG1) were found to be significantly downregulated in tumors compared to normal tissues [PMC6827104]. Similar to humans, it has been documented that miRNAs such as cfa-mir-96 and -149 are oncogenic and tumor-suppressive in dogs as well [PMC9610006]. Additionally, several differentially methylated regions (DMRs) were identified from the promoter regions of various miRNAs including cfa-mir-96 and cfa-miR-149 in CMT tissues [PMC9455804]. These findings suggest that cfa-mir-96 plays a role as an oncogenic miRNA in CMTs through its target genes and promoter hypomethylation. Conversely, cfa-miR-149 acts as a tumor-suppressive miRNA through its decreased expression and promoter hypermethylation. These observations highlight the importance of these miRNAs in canine mammary cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCACUAGCACAUUUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-96-5p
  2. Bos taurus (cattle) bta-miR-96
  3. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-96-5p
  4. Branchiostoma floridae bfl-miR-96-5p
  5. Branchiostoma lanceolatum (amphioxus) Bla-Mir-96-P1_5p (mature (guide))
  6. Callithrix jacchus cja-miR-96
  7. Callorhinchus milii Cmi-Mir-96-P1_5p (mature (guide))
  8. Cavia porcellus cpo-miR-96-5p
  9. Cervus elaphus (red deer) cel-miR-96
  10. Chrysemys picta bellii Cpi-Mir-96-P1_5p (mature (guide))
  11. Columba livia cli-miR-96-5p
  12. Cyprinus carpio ccr-miR-96
  13. Danio rerio dre-miR-96-5p
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-96-5p
  15. Echinops telfairi Ete-Mir-96-P1_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-96
  17. Gadus morhua (Atlantic cod) gmo-miR-96-5p
  18. Gallus gallus (chicken) Gga-Mir-96-P1_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-96-P1_5p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-96
  21. Homo sapiens (human) hsa-miR-96-5p
  22. Ictalurus punctatus ipu-miR-96
  23. Latimeria chalumnae Lch-Mir-96-P1_5p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-96-P1_5p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) Mml-Mir-96-P1_5p (mature (guide))
  26. Maylandia zebra (zebra mbuna) mze-miR-96
  27. Microcaecilia unicolor Mun-Mir-96-P1_5p (mature (guide))
  28. Monodelphis domestica (gray short-tailed opossum) mdo-miR-96
  29. Monopterus albus Mal-Mir-96-P1b_5p (mature (guide))
  30. Mus musculus (house mouse) mmu-miR-96-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-96
  32. Ophiophagus hannah (king cobra) oha-miR-96
  33. Oreochromis niloticus oni-miR-96
  34. Ornithorhynchus anatinus (platypus) oan-miR-96-5p
  35. Oryctolagus cuniculus ocu-miR-96-5p
  36. Pongo pygmaeus ppy-miR-96
  37. Pteropus alecto (black flying fox) pal-miR-96-5p
  38. Pundamilia nyererei pny-miR-96
  39. Python bivittatus pbv-miR-96-5p
  40. Rattus norvegicus rno-miR-96-5p
  41. Salmo salar ssa-miR-96-5p
  42. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-96-P1_5p (mature (guide))
  43. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P1_5p (mature (guide))
  44. Sphenodon punctatus (tuatara) Spt-Mir-96-P1_5p (mature (guide))
  45. Sus scrofa ssc-miR-96-5p
  46. Taeniopygia guttata Tgu-Mir-96-P1_5p (mature (guide))
  47. Takifugu rubripes (torafugu) fru-miR-96
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-96
  49. Tor tambroides (Thai mahseer) miR-96-5p
  50. Xenopus laevis xla-miR-96-5p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-96
Publications