v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-96-5p URS000016FF9C_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-96: Mmu-mir-96 is a microRNA that is upregulated in the deciduoma and is believed to play a role in the regulation of decidual cells to maintain pregnancy [PMC5364990]. In a study, fragments of the 3'-untranslated region of Bcl2, which contained the predicted binding site for mmu-mir-96, were cloned into pcDNA3.1/EGFP constructs at specific sites [PMC5364990]. This suggests that mmu-mir-96 may interact with Bcl2 and potentially regulate its expression. The upregulation of mmu-mir-96 in the deciduoma may be a mechanism to ensure proper functioning of decidual cells during pregnancy [PMC5364990]. Further research is needed to fully understand the specific role and mechanism of action of mmu-mir-96 in maintaining pregnancy.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGGCACUAGCACAUUUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-96-5p
  2. Bos taurus (cattle) bta-miR-96
  3. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-96-5p
  4. Branchiostoma floridae bfl-miR-96-5p
  5. Branchiostoma lanceolatum (amphioxus) Bla-Mir-96-P1_5p (mature (guide))
  6. Callithrix jacchus cja-miR-96
  7. Callorhinchus milii Cmi-Mir-96-P1_5p (mature (guide))
  8. Canis lupus familiaris cfa-miR-96
  9. Cavia porcellus cpo-miR-96-5p
  10. Cervus elaphus (red deer) cel-miR-96
  11. Chrysemys picta bellii Cpi-Mir-96-P1_5p (mature (guide))
  12. Columba livia cli-miR-96-5p
  13. Cyprinus carpio ccr-miR-96
  14. Danio rerio dre-miR-96-5p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-96-5p
  16. Echinops telfairi Ete-Mir-96-P1_5p (mature (guide))
  17. Equus caballus (horse) eca-miR-96
  18. Gadus morhua (Atlantic cod) gmo-miR-96-5p
  19. Gallus gallus (chicken) Gga-Mir-96-P1_5p (mature (guide))
  20. Gekko japonicus Gja-Mir-96-P1_5p (mature (guide))
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-96
  22. Homo sapiens (human) hsa-miR-96-5p
  23. Ictalurus punctatus ipu-miR-96
  24. Latimeria chalumnae Lch-Mir-96-P1_5p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-96-P1_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) Mml-Mir-96-P1_5p (mature (guide))
  27. Maylandia zebra (zebra mbuna) mze-miR-96
  28. Microcaecilia unicolor Mun-Mir-96-P1_5p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-96
  30. Monopterus albus Mal-Mir-96-P1b_5p (mature (guide))
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-96
  32. Ophiophagus hannah (king cobra) oha-miR-96
  33. Oreochromis niloticus oni-miR-96
  34. Ornithorhynchus anatinus (platypus) oan-miR-96-5p
  35. Oryctolagus cuniculus ocu-miR-96-5p
  36. Pongo pygmaeus ppy-miR-96
  37. Pteropus alecto (black flying fox) pal-miR-96-5p
  38. Pundamilia nyererei pny-miR-96
  39. Python bivittatus pbv-miR-96-5p
  40. Rattus norvegicus rno-miR-96-5p
  41. Salmo salar ssa-miR-96-5p
  42. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-96-P1_5p (mature (guide))
  43. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P1_5p (mature (guide))
  44. Sphenodon punctatus (tuatara) Spt-Mir-96-P1_5p (mature (guide))
  45. Sus scrofa ssc-miR-96-5p
  46. Taeniopygia guttata Tgu-Mir-96-P1_5p (mature (guide))
  47. Takifugu rubripes (torafugu) fru-miR-96
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-96
  49. Tor tambroides (Thai mahseer) miR-96-5p
  50. Xenopus laevis xla-miR-96-5p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-96
 Publications