Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-96-5p URS000016FF9C_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 8 databases (MirGeneDB, RefSeq, PSICQUIC, PirBase, miRBase, LncBase, TarBase, ENA). Described in 43 papers. Mus musculus (house mouse) mmu-miR-96-5p sequence is a product of miR-96-5p, 96, Mir96, miR-96, mmu-miR-96-5p, mmu-miR-96 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1200007E24Rik, 1500009K01Rik, 1700120C01Rik, 3010033P07Rik, 3830420B02Rik, 4930471C18Rik, 5033430J04Rik, AIGP1, APG16L, Atg16l1.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-96-5p interacts with:

Interaction id Participant Synonyms
URS000016FF9C_10090-0 P28334 P28334
URS000016FF9C_10090-1 P28334 P28334

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGGCACUAGCACAUUUUUGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 76 other species

    1. Alligator mississippiensis ami-miR-96-5p
    2. Bos taurus (cattle) bta-miR-96
    3. Branchiostoma belcheri bbe-miR-96-5p
    4. Branchiostoma floridae bfl-miR-96-5p
    5. Callithrix jacchus cja-miR-96
    6. Callorhinchus milii (elephant shark) eshark_mir-96_1
    7. Canis lupus familiaris cfa-miR-96
    8. Cavia porcellus (domestic guinea pig) cpo-miR-96-5p
    9. Cervus elaphus (red deer) cel-miR-96
    10. Chrysemys picta bellii Cpi-Mir-96-P1_5p (mature (guide))
    11. Columba livia (rock pigeon) cli-miR-96-5p
    12. Cyprinus carpio ccr-miR-96
    13. Danio rerio (zebrafish) dre-miR-96-5p
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-96-5p
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-96-P1_5p (mature (guide))
    16. Equus caballus (horse) eca-miR-96
    17. Gadus morhua gmo-miR-96-5p
    18. Gallus gallus (chicken) Gga-Mir-96-P1_5p (mature (guide))
    19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-96
    20. Homo sapiens hsa-miR-96-5p
    21. Ictalurus punctatus (channel catfish) ipu-miR-96
    22. Macaca mulatta Mml-Mir-96-P1_5p (mature (guide))
    23. Maylandia zebra mze-miR-96
    24. Monodelphis domestica mdo-miR-96
    25. Neolamprologus brichardi nbr-miR-96
    26. Ophiophagus hannah oha-miR-96
    27. Oreochromis niloticus oni-miR-96
    28. Ornithorhynchus anatinus oan-miR-96-5p
    29. Oryctolagus cuniculus (rabbit) ocu-miR-96-5p
    30. Pongo pygmaeus ppy-miR-96
    31. Pteropus alecto pal-miR-96-5p
    32. Pundamilia nyererei pny-miR-96
    33. Python bivittatus pbv-miR-96-5p
    34. Rattus norvegicus rno-miR-96-5p
    35. Salmo salar (Atlantic salmon) ssa-miR-96-5p
    36. Sarcophilus harrisii Sha-Mir-96-P1_5p (mature (guide))
    37. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P1_5p (mature (guide))
    38. Sus scrofa ssc-miR-96-5p
    39. Taeniopygia guttata (zebra finch) Tgu-Mir-96-P1_5p (mature (guide))
    40. Takifugu rubripes (torafugu) fru-miR-96
    41. Tetraodon nigroviridis tni-miR-96
    42. Tor tambroides miR-96-5p
    43. Xenopus laevis (African clawed frog) xla-miR-96-5p
    44. Xenopus tropicalis xtr-miR-96