Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-10a-5p URS000016D2D4_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, ENA, PirBase, LncBase, TarBase, miRBase). Described in 26 papers. Mus musculus (house mouse) mmu-miR-10a-5p sequence is a product of miR-10a, mmu-miR-10a, mmu-miR-10a-5p, Mir10a, miR-10, miR-10a-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610038P07Rik, 1190002A23Rik, 1200006O09Rik, 2810408K05Rik, 3110012M15Rik, 4733401N12Rik, 4930443L17Rik, 4933426M11Rik, 5031424B04Rik, 9430038B09Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACCCUGUAGAUCCGAAUUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Alligator mississippiensis ami-miR-10a-5p
    2. Anolis carolinensis aca-miR-10a-5p
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-10a
    4. Bos taurus (cattle) bta-miR-10a
    5. Branchiostoma floridae bfl-miR-10a-5p
    6. Branchiostoma lanceolatum miR-10
    7. Callorhinchus milii (elephant shark) miR-10a
    8. Capra hircus miR-10a
    9. Columba livia (rock pigeon) cli-miR-10a-5p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-10a-5p
    11. Eisenia fetida (common brandling worm) Efe-Mir-10-P1e_5p (mature (guide))
    12. Equus caballus (horse) eca-miR-10a
    13. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-1287
    14. Gorilla gorilla (western gorilla) ggo-miR-10a
    15. Homo sapiens hsa-miR-10a-5p
    16. Macaca mulatta mml-miR-10a-5p
    17. Monodelphis domestica mdo-miR-10a-5p
    18. Ophiophagus hannah oha-miR-10a-5p
    19. Ovis aries miscellaneous RNA
    20. Pan paniscus ppa-miR-10a
    21. Pan troglodytes (chimpanzee) ptr-miR-10a
    22. Pongo pygmaeus ppy-miR-10a
    23. Ptychodera flava Pfl-Mir-10-P1_5p (mature (guide))
    24. Python bivittatus pbv-miR-10a-5p
    25. Rattus norvegicus rno-miR-10a-5p
    26. Saccoglossus kowalevskii sko-miR-10
    27. Saguinus labiatus sla-miR-10a
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P1a-v1_5p (mature (guide))
    29. Xenopus tropicalis xtr-miR-10a