Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-151a-3p URS000016C318_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-151a: Hsa-mir-151a is a microRNA that has been found to be differentially expressed in various studies. It has been shown to be highly expressed in network analysis studies [PMC8903000]. Additionally, hsa-mir-151a has been associated with Helicobacter pylori (H. pylori) infection [PMC9409130]. In lung adenocarcinoma (LAC) patients, hsa-mir-151a is significantly overexpressed in NSCLC tissue compared to normal tissue [PMC5541717]. The expression level of hsa-mir-151a is downregulated following MG induction [PMC7393356]. Hsa-mir-151a has also been found to modulate genes involved in various pathways, including adherens, angiogenesis, cell cycle, and wound healing pathways [PMC7393356]. It has been shown to target the transcript ENST00000292174 that encodes for C–X–C motif chemokine receptor protein [PMC7393356]. Hsa-mir-151a promotes metastasis and inhibits RhoGDIA by functioning synergistically with FAK [PMC8486515]. It has also been identified as a putative shared miRNA eQTL and miRNA eQTLs that appear to be shared between cells and exosomes [PMC5217120]. Hsa-mir-151a is differentially regulated genes involved in cell adhesion, angiogenesis, cell cycle, JAK-STAT signaling, MAPK signaling, NO signaling, and VEGF signaling pathways favoring angiogenesis [PMC8493071]. However, the confirmation of hsa-mir-151a as a microRNA was not successful in some studies [PMC5675613]. Overall, hsa-mir-151a plays a significant role in various biological processes and disease conditions.

hsa-mir-28: hsa-mir-28 is a microRNA that is over-expressed in resting CD4+T cells and has been reported to target the 3' end of human HIV-1 RNA, leading to the silencing of viral proteins [PMC4070032]. In a study comparing MMVP specimens and FED samples, it was found that the expression of hsa-mir-28 was lower in MMVP specimens [PMC4881574]. Several articles have indicated that hsa-mir-28-5p has inhibitory activity in vitro, suggesting its potential role in tumor suppression [PMC8752235]. hsa-mir-28, along with hsa-miR-548 family, has been identified as being derived from genetic elements [PMC2952848]. Among the 10 most highly expressed miRNAs, hsa-mir-28 appeared only once in tenth place [PMC4486185].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAGACUGAAGCUCCUUGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus bta-miR-151-3p
  2. Capra hircus chi-miR-151-3p
  3. Cervus elaphus (red deer) cel-miR-151
  4. Dasypus novemcinctus dno-miR-151-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-151-3p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-48850797
  7. Oryctolagus cuniculus (rabbit) ocu-miR-151-3p
  8. Pan troglodytes ptr-miR-151
  9. Pongo pygmaeus ppy-miR-151a-3p
Publications