Dasypus novemcinctus (nine-banded armadillo) dno-miR-151-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-151-3p URS000016C318_9361

21 nucleotides
1 database (miRBase)
Found in 9 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUAGACUGAAGCUCCUUGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Bos taurus bta-miR-151-3p
Capra hircus chi-miR-151-3p
Cervus elaphus (red deer) cel-miR-151
Homo sapiens hsa-miR-151a-3p
Macaca mulatta (Rhesus monkey) mml-miR-151-3p
Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-48850797
Oryctolagus cuniculus (rabbit) ocu-miR-151-3p
Pan troglodytes ptr-miR-151
Pongo pygmaeus ppy-miR-151a-3p