v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
RNA (84-MER) from Methanocaldococcus jannaschii (PDB 2ZZM, chain B) secondary structure diagram

RNA (84-MER) from Methanocaldococcus jannaschii (PDB 2ZZM, chain B) URS00001612D2_2190

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGGGGUCGCCAAGCCUGGCCAAAGGCGCUGGGCCUAGGACCCAGUCCCGUAGGGGUUCCAGGGUUCAAAUCCCUGCCCCUGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Methanocaldococcus bathoardescens tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  2. Methanocaldococcus fervens AG86 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  3. Methanocaldococcus jannaschii DSM 2661 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  4. Methanocaldococcus sp. FS406-22 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  5. Methanocaldococcus lauensis tRNA-Leu
  6. Methanocaldococcus lauensis tRNA-Leu
 2D structure Publications