Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Methanocaldococcus sp. FS406-22 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) secondary structure diagram

Methanocaldococcus sp. FS406-22 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1) URS00001612D2_644281

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGGGGUCGCCAAGCCUGGCCAAAGGCGCUGGGCCUAGGACCCAGUCCCGUAGGGGUUCCAGGGUUCAAAUCCCUGCCCCUGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Methanocaldococcus bathoardescens tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  2. Methanocaldococcus fervens AG86 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  3. Methanocaldococcus jannaschii DSM 2661 tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
  4. Methanocaldococcus lauensis tRNA-Leu
  5. Methanocaldococcus lauensis tRNA-Leu
  6. Methanocaldococcus jannaschii RNA (84-MER) from Methanocaldococcus jannaschii (PDB 2ZZM, chain B)
2D structure Publications