v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-192 URS0000155642_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-192: Ssc-mir-192 is a microRNA that is down-regulated in adipose tissues in high-FE pigs compared to low-FE pigs, along with ssc-miR-122-5p [PMC9778086]. Another study confirmed that ssc-mir-192 is downregulated in response to LPS, along with ssc-miR-215 [PMC4613317]. Additionally, the study showed that ssc-miR-146a-5p, ssc-miR-221-5p, and ssc-miR-148b-3p were significantly upregulated by LPS [PMC4613317]. These findings were validated using qualitative qPCR [PMC4613317].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGACCUAUGAAUUGACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Mir-192-P2_5p (mature (guide))
  2. Canis lupus familiaris cfa-miR-192
  3. Capra hircus chi-miR-192-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-192-5p
  5. Cervus elaphus cel-miR-192
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-192-P2_5p (mature (guide))
  7. Equus caballus (horse) eca-miR-192
  8. Gorilla gorilla gorilla ggo-miR-192 (MIR192)
  9. Gorilla gorilla ggo-miR-192
  10. Homo sapiens (human) hsa-miR-192-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-192-5p
  12. Mus musculus (house mouse) mmu-miR-192-5p
  13. Nomascus leucogenys nle-miR-192
  14. Ornithorhynchus anatinus oan-miR-192-5p
  15. Oryctolagus cuniculus Ocu-Mir-192-P2_5p (mature (guide))
  16. Otolemur garnettii oga-miR-192
  17. Pan paniscus ppa-miR-192
  18. Pan troglodytes (chimpanzee) ptr-miR-192
  19. Pongo pygmaeus (Bornean orangutan) ppy-miR-192
  20. Rattus norvegicus (Norway rat) rno-miR-192-5p
  21. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-192-P2_5p (mature (guide))
  22. Tupaia chinensis tch-miR-192-5p
 Publications