Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-192 URS0000155642_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGACCUAUGAAUUGACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Mir-192-P2_5p (mature (guide))
  2. Canis lupus familiaris cfa-miR-192
  3. Capra hircus chi-miR-192-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-192-5p
  5. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-192-P2_5p (mature (guide))
  6. Equus caballus (horse) eca-miR-192
  7. Gorilla gorilla gorilla ggo-miR-192 (MIR192)
  8. Gorilla gorilla ggo-miR-192
  9. Homo sapiens (human) hsa-miR-192-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-192-5p
  11. Mus musculus (house mouse) mmu-miR-192-5p
  12. Nomascus leucogenys nle-miR-192
  13. Ornithorhynchus anatinus oan-miR-192-5p
  14. Oryctolagus cuniculus Ocu-Mir-192-P2_5p (mature (guide))
  15. Otolemur garnettii oga-miR-192
  16. Pan paniscus ppa-miR-192
  17. Pan troglodytes (chimpanzee) ptr-miR-192
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-192
  19. Rattus norvegicus (Norway rat) rno-miR-192-5p
  20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-192-P2_5p (mature (guide))
  21. Sus scrofa (pig) ssc-miR-192
  22. Tupaia chinensis tch-miR-192-5p