Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-192-5p URS0000155642_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-192: Mmu-mir-192 is a microRNA that has been studied in the context of high-fat diet (HFD)-induced obesity. In a microarray experiment, it was found that mmu-mir-192 was downregulated in white adipose tissue (WAT) in response to HFD feeding [1]. This downregulation of mmu-mir-192 was also observed in another study on HFD-induced obesity [2]. The downregulation of mmu-mir-192 is described for the first time and requires further investigation [2]. Mmu-mir-192 has been found to target Zeb1 and Zeb2, which regulate epithelial to mesenchymal transition [2]. Mmu-mir-192 is highly expressed in both the small and large intestine [3]. In a study on non-alcoholic fatty liver disease (NAFLD), it was found that liver cells exposed to excessive lipids released exosomes containing higher amounts of mmu-miR-122 and mmu-mir-192 [4]. The loss of mmu-mir-192 has been associated with impaired intestinal barrier function and spontaneous intestinal inflammation [5] [6]. In another study, mmu-miR-192 was found to be downregulated, along with other miRNAs, in response to a specific treatment [7]. References: [1] PMC4571067 [2] PMC3319598 [3] PMC5618556 [4] PMC7936154 [5] PMC4292042 [6] PMC7426649 [7] PMC9198802

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGACCUAUGAAUUGACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus Bta-Mir-192-P2_5p (mature (guide))
  2. Canis lupus familiaris cfa-miR-192
  3. Capra hircus chi-miR-192-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-192-5p
  5. Cervus elaphus cel-miR-192
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-192-P2_5p (mature (guide))
  7. Equus caballus (horse) eca-miR-192
  8. Gorilla gorilla gorilla ggo-miR-192 (MIR192)
  9. Gorilla gorilla ggo-miR-192
  10. Homo sapiens (human) hsa-miR-192-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-192-5p
  12. Nomascus leucogenys nle-miR-192
  13. Ornithorhynchus anatinus oan-miR-192-5p
  14. Oryctolagus cuniculus Ocu-Mir-192-P2_5p (mature (guide))
  15. Otolemur garnettii oga-miR-192
  16. Pan paniscus ppa-miR-192
  17. Pan troglodytes (chimpanzee) ptr-miR-192
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-192
  19. Rattus norvegicus (Norway rat) rno-miR-192-5p
  20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-192-P2_5p (mature (guide))
  21. Sus scrofa (pig) ssc-miR-192
  22. Tupaia chinensis tch-miR-192-5p
Publications