Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-490 URS00001496AE_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACCUGGAGGACUCCAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-490-3p
  2. Bos taurus bta-miR-490
  3. Equus caballus eca-miR-490-3p
  4. Gallus gallus (chicken) gga-miR-490-3p
  5. Gorilla gorilla gorilla ggo-miR-490 (MIR490)
  6. Gorilla gorilla (western gorilla) ggo-miR-490
  7. Homo sapiens hsa-miR-490-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-490-3p
  9. Mus musculus (house mouse) mmu-miR-490-3p
  10. Pan troglodytes (chimpanzee) ptr-miR-490
  11. Pongo pygmaeus ppy-miR-490-3p
  12. Rattus norvegicus rno-miR-490-3p
  13. Sus scrofa ssc-miR-490-3p
Publications