v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) ami-miR-490-3p URS00001496AE_8496

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAACCUGGAGGACUCCAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus bta-miR-490
  2. Canis lupus familiaris (dog) cfa-miR-490
  3. Equus caballus eca-miR-490-3p
  4. Gallus gallus gga-miR-490-3p
  5. Gorilla gorilla gorilla ggo-miR-490 (MIR490)
  6. Gorilla gorilla (western gorilla) ggo-miR-490
  7. Homo sapiens (human) hsa-miR-490-3p
  8. Macaca mulatta mml-miR-490-3p
  9. Mus musculus (house mouse) mmu-miR-490-3p
  10. Pan troglodytes (chimpanzee) ptr-miR-490
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-490-3p
  12. Rattus norvegicus rno-miR-490-3p
  13. Sus scrofa ssc-miR-490-3p