Homo sapiens (human) hsa-miR-490-3p URS00001496AE_9606

• 22 nucleotides
• 8 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, RefSeq, TarBase)
• Found in 13 other species
• 377 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CAACCUGGAGGACUCCAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Alligator mississippiensis ami-miR-490-3p
2. Bos taurus bta-miR-490
3. Canis lupus familiaris (dog) cfa-miR-490
4. Equus caballus eca-miR-490-3p
5. Gallus gallus gga-miR-490-3p
6. Gorilla gorilla gorilla ggo-miR-490 (MIR490)
7. Gorilla gorilla (western gorilla) ggo-miR-490
8. Macaca mulatta mml-miR-490-3p
9. Mus musculus (house mouse) mmu-miR-490-3p
10. Pan troglodytes (chimpanzee) ptr-miR-490
11. Pongo pygmaeus (Bornean orangutan) ppy-miR-490-3p
12. Rattus norvegicus rno-miR-490-3p
13. Sus scrofa ssc-miR-490-3p

Publications Download

• FASTA
• JSON