v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-490-3p URS00001496AE_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, TarBase, LncBase, ENA, RefSeq, IntAct, MalaCards, GeneCards). Homo sapiens (human) hsa-miR-490-3p sequence is a product of MIR-RG-85, HSA-MIR-RG-85, hsa-miR-490, hsa-miR-490-3p, MIR490, miR-490-3p, miR-490 genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1A1-3B, 225, 4832404P21Rik, A1CF, AATF, ABC7, ABCB7, ABHD21, ACF, ACF64.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-490-3p interacts with:

Interaction id Participant Synonyms
EBI-25470735 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25470867 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CAACCUGGAGGACUCCAUGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Alligator mississippiensis (American alligator) ami-miR-490-3p
    2. Anolis carolinensis Aca-Mir-490_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-490
    4. Canis lupus familiaris cfa-miR-490
    5. Chrysemys picta bellii Cpi-Mir-490_3p (mature (guide))
    6. Columba livia (rock pigeon) Cli-Mir-490_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-490-3p
    8. Gallus gallus gga-miR-490-3p
    9. Gorilla gorilla ggo-miR-490
    10. Macaca mulatta mml-miR-490-3p
    11. Mus musculus (house mouse) mmu-miR-490-3p
    12. Ornithorhynchus anatinus Oan-Mir-490_3p (mature (guide))
    13. Pan troglodytes (chimpanzee) ptr-miR-490
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-490-3p
    15. Rattus norvegicus rno-miR-490-3p
    16. Sus scrofa ssc-miR-490-3p
     Publications